Incidental Mutation 'R6446:Ccr1'
ID519197
Institutional Source Beutler Lab
Gene Symbol Ccr1
Ensembl Gene ENSMUSG00000025804
Gene Namechemokine (C-C motif) receptor 1
SynonymsCmkbr1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.162) question?
Stock #R6446 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location123962124-123968692 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 123964106 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 129 (I129T)
Ref Sequence ENSEMBL: ENSMUSP00000026911 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026911]
Predicted Effect probably damaging
Transcript: ENSMUST00000026911
AA Change: I129T

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000026911
Gene: ENSMUSG00000025804
AA Change: I129T

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 45 316 5.1e-8 PFAM
Pfam:7tm_1 51 301 8.5e-52 PFAM
Meta Mutation Damage Score 0.316 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 93.9%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the beta chemokine receptor family, which is predicted to be a seven transmembrane protein similar to G protein-coupled receptors. The ligands of this receptor include macrophage inflammatory protein 1 alpha (MIP-1 alpha), regulated on activation normal T expressed and secreted protein (RANTES), monocyte chemoattractant protein 3 (MCP-3), and myeloid progenitor inhibitory factor-1 (MPIF-1). Chemokines and their receptors mediated signal transduction are critical for the recruitment of effector immune cells to the site of inflammation. Knockout studies of the mouse homolog suggested the roles of this gene in host protection from inflammatory response, and susceptibility to virus and parasite. This gene and other chemokine receptor genes, including CCR2, CCRL2, CCR3, CCR5 and CCXCR1, are found to form a gene cluster on chromosome 3p. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit altered trafficking and proliferation of myeloid progenitor cells, and impairments in granulomatous inflammation of the lung and neutrophil associated host defense. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp13a3 A G 16: 30,361,869 L114P probably benign Het
Blm GCCTCCTCCTCCTCCTCCTCCTCCTCCTCC GCCTCCTCCTCCTCCTCCTCCTCCTCC 7: 80,512,904 probably benign Het
Catsperg1 T C 7: 29,206,567 I196V probably benign Het
Cbx2 T A 11: 119,027,926 S106T probably benign Het
Ccar2 T A 14: 70,143,069 E354V probably benign Het
Cdkl2 T A 5: 92,033,217 I188F probably damaging Het
Cep350 T C 1: 155,862,154 N2648D probably benign Het
Chtf18 A G 17: 25,721,244 S658P probably benign Het
Csnka2ip G A 16: 64,479,381 Q207* probably null Het
Dennd5a A G 7: 109,894,666 L1253P probably damaging Het
Dennd6a T A 14: 26,629,534 I374K probably damaging Het
Dut T C 2: 125,251,019 probably null Het
Gcm1 T C 9: 78,059,783 Y95H probably benign Het
Gm4951 A G 18: 60,245,768 D125G probably damaging Het
Grid2 A T 6: 64,345,593 I526F probably damaging Het
Hectd4 T A 5: 121,334,375 Y2725N possibly damaging Het
Helq A T 5: 100,768,384 N907K possibly damaging Het
Hpse G A 5: 100,695,569 Q246* probably null Het
Kcnj15 C T 16: 95,296,259 H247Y probably benign Het
Kif27 C A 13: 58,345,716 V138F probably damaging Het
Map7 T G 10: 20,278,233 D698E unknown Het
Mtmr11 A T 3: 96,171,188 S687C probably benign Het
Ncbp2 CGTCTGGATG CG 16: 31,956,343 probably null Het
Nup210l G A 3: 90,172,068 G953E probably damaging Het
Olfr297 T A 7: 86,527,102 I115N possibly damaging Het
Piezo2 G T 18: 63,086,607 P792T probably damaging Het
Pld3 T C 7: 27,537,731 D241G probably damaging Het
Prss35 G T 9: 86,755,653 V159F probably damaging Het
Rimbp3 A T 16: 17,212,929 M1406L probably benign Het
Serpina3g T C 12: 104,239,082 F27L probably damaging Het
Setd1b G A 5: 123,161,799 probably benign Het
Sh3glb1 T C 3: 144,705,605 K13E probably damaging Het
Slc29a1 A T 17: 45,589,245 I217N possibly damaging Het
Spag17 A T 3: 100,103,132 T1981S probably benign Het
Svil A C 18: 5,057,323 E590D probably benign Het
Synm A G 7: 67,734,966 S541P probably damaging Het
Vmn2r108 A T 17: 20,472,347 Y82* probably null Het
Other mutations in Ccr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Ccr1 APN 9 123964053 missense probably benign 0.22
IGL00550:Ccr1 APN 9 123963636 missense probably damaging 1.00
IGL00934:Ccr1 APN 9 123963740 missense probably damaging 0.98
IGL01795:Ccr1 APN 9 123964112 nonsense probably null
IGL02447:Ccr1 APN 9 123963716 missense probably benign 0.01
PIT4431001:Ccr1 UTSW 9 123964194 missense probably benign
PIT4466001:Ccr1 UTSW 9 123963728 missense probably damaging 0.99
PIT4472001:Ccr1 UTSW 9 123963728 missense probably damaging 0.99
R0900:Ccr1 UTSW 9 123964334 missense possibly damaging 0.50
R0931:Ccr1 UTSW 9 123963790 missense probably damaging 1.00
R1165:Ccr1 UTSW 9 123963494 missense possibly damaging 0.51
R1386:Ccr1 UTSW 9 123963962 missense probably benign 0.05
R1513:Ccr1 UTSW 9 123964473 missense probably benign 0.00
R1615:Ccr1 UTSW 9 123963536 missense probably benign 0.00
R1833:Ccr1 UTSW 9 123964089 missense probably damaging 1.00
R1996:Ccr1 UTSW 9 123963514 missense probably benign 0.41
R3833:Ccr1 UTSW 9 123964287 missense possibly damaging 0.74
R4085:Ccr1 UTSW 9 123963950 missense probably benign
R4545:Ccr1 UTSW 9 123964400 missense probably benign 0.11
R4745:Ccr1 UTSW 9 123963948 missense probably benign 0.05
R5369:Ccr1 UTSW 9 123964289 missense probably damaging 0.98
R5415:Ccr1 UTSW 9 123964376 missense probably damaging 1.00
R5416:Ccr1 UTSW 9 123964376 missense probably damaging 1.00
R7179:Ccr1 UTSW 9 123964052 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGGCTCTTGTAGGGGAAATG -3'
(R):5'- TCATGCAGCATAGGAGGCTTC -3'

Sequencing Primer
(F):5'- CTCTTGTAGGGGAAATGAGGGCTAC -3'
(R):5'- AGCATGACCAGCATCTACCTGTTC -3'
Posted On2018-05-24