Incidental Mutation 'R6446:Map7'
ID519198
Institutional Source Beutler Lab
Gene Symbol Map7
Ensembl Gene ENSMUSG00000019996
Gene Namemicrotubule-associated protein 7
SynonymsE-MAP-115, mste, ste, Mtap7, mshi
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.360) question?
Stock #R6446 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location20148471-20281590 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 20278233 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 698 (D698E)
Ref Sequence ENSEMBL: ENSMUSP00000111963 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020173] [ENSMUST00000116259]
Predicted Effect unknown
Transcript: ENSMUST00000020173
AA Change: D690E
SMART Domains Protein: ENSMUSP00000020173
Gene: ENSMUSG00000019996
AA Change: D690E

DomainStartEndE-ValueType
low complexity region 5 17 N/A INTRINSIC
low complexity region 55 85 N/A INTRINSIC
coiled coil region 89 152 N/A INTRINSIC
low complexity region 365 375 N/A INTRINSIC
low complexity region 379 392 N/A INTRINSIC
Pfam:MAP7 447 616 1.1e-59 PFAM
internal_repeat_1 623 658 5.23e-6 PROSPERO
internal_repeat_1 699 736 5.23e-6 PROSPERO
Predicted Effect unknown
Transcript: ENSMUST00000116259
AA Change: D698E
SMART Domains Protein: ENSMUSP00000111963
Gene: ENSMUSG00000019996
AA Change: D698E

DomainStartEndE-ValueType
low complexity region 5 17 N/A INTRINSIC
low complexity region 55 85 N/A INTRINSIC
coiled coil region 89 152 N/A INTRINSIC
low complexity region 365 375 N/A INTRINSIC
low complexity region 379 392 N/A INTRINSIC
Pfam:MAP7 453 611 4.7e-46 PFAM
internal_repeat_1 623 656 2.41e-5 PROSPERO
internal_repeat_1 699 734 2.41e-5 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213372
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215889
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216308
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217535
Meta Mutation Damage Score 0.094 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 93.9%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a microtubule-associated protein that is predominantly expressed in cells of epithelial origin. Microtubule-associated proteins are thought to be involved in microtubule dynamics, which is essential for cell polarization and differentiation. This protein has been shown to be able to stabilize microtubules, and may serve to modulate microtubule functions. Studies of the related mouse protein also suggested an essential role in microtubule function required for spermatogenesis. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2010]
PHENOTYPE: Males homozygous for mutations in this marker are sterile with small, disorganized testes, small epidiymis and seminiferous tubules. They have deformed spermatid nuclei and a block in spermatogenesis. Aberrant microtubules are seen in elongating spermatids and sertoli cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp13a3 A G 16: 30,361,869 L114P probably benign Het
Blm GCCTCCTCCTCCTCCTCCTCCTCCTCCTCC GCCTCCTCCTCCTCCTCCTCCTCCTCC 7: 80,512,904 probably benign Het
Catsperg1 T C 7: 29,206,567 I196V probably benign Het
Cbx2 T A 11: 119,027,926 S106T probably benign Het
Ccar2 T A 14: 70,143,069 E354V probably benign Het
Ccr1 A G 9: 123,964,106 I129T probably damaging Het
Cdkl2 T A 5: 92,033,217 I188F probably damaging Het
Cep350 T C 1: 155,862,154 N2648D probably benign Het
Chtf18 A G 17: 25,721,244 S658P probably benign Het
Csnka2ip G A 16: 64,479,381 Q207* probably null Het
Dennd5a A G 7: 109,894,666 L1253P probably damaging Het
Dennd6a T A 14: 26,629,534 I374K probably damaging Het
Dut T C 2: 125,251,019 probably null Het
Gcm1 T C 9: 78,059,783 Y95H probably benign Het
Gm4951 A G 18: 60,245,768 D125G probably damaging Het
Grid2 A T 6: 64,345,593 I526F probably damaging Het
Hectd4 T A 5: 121,334,375 Y2725N possibly damaging Het
Helq A T 5: 100,768,384 N907K possibly damaging Het
Hpse G A 5: 100,695,569 Q246* probably null Het
Kcnj15 C T 16: 95,296,259 H247Y probably benign Het
Kif27 C A 13: 58,345,716 V138F probably damaging Het
Mtmr11 A T 3: 96,171,188 S687C probably benign Het
Ncbp2 CGTCTGGATG CG 16: 31,956,343 probably null Het
Nup210l G A 3: 90,172,068 G953E probably damaging Het
Olfr297 T A 7: 86,527,102 I115N possibly damaging Het
Piezo2 G T 18: 63,086,607 P792T probably damaging Het
Pld3 T C 7: 27,537,731 D241G probably damaging Het
Prss35 G T 9: 86,755,653 V159F probably damaging Het
Rimbp3 A T 16: 17,212,929 M1406L probably benign Het
Serpina3g T C 12: 104,239,082 F27L probably damaging Het
Setd1b G A 5: 123,161,799 probably benign Het
Sh3glb1 T C 3: 144,705,605 K13E probably damaging Het
Slc29a1 A T 17: 45,589,245 I217N possibly damaging Het
Spag17 A T 3: 100,103,132 T1981S probably benign Het
Svil A C 18: 5,057,323 E590D probably benign Het
Synm A G 7: 67,734,966 S541P probably damaging Het
Vmn2r108 A T 17: 20,472,347 Y82* probably null Het
Other mutations in Map7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01456:Map7 APN 10 20273804 missense unknown
IGL03019:Map7 APN 10 20267355 missense unknown
IGL03263:Map7 APN 10 20245322 nonsense probably null
R0893:Map7 UTSW 10 20273883 splice site probably null
R1172:Map7 UTSW 10 20245299 missense probably damaging 1.00
R2097:Map7 UTSW 10 20246616 missense probably damaging 1.00
R2239:Map7 UTSW 10 20278282 missense unknown
R3760:Map7 UTSW 10 20276281 splice site probably benign
R3980:Map7 UTSW 10 20267353 missense unknown
R5009:Map7 UTSW 10 20261918 nonsense probably null
R5397:Map7 UTSW 10 20273321 missense unknown
R5422:Map7 UTSW 10 20266766 missense probably damaging 0.99
R5501:Map7 UTSW 10 20276202 missense unknown
R5664:Map7 UTSW 10 20267359 missense unknown
R5773:Map7 UTSW 10 20246644 missense probably benign 0.22
R6209:Map7 UTSW 10 20276280 splice site probably null
R6438:Map7 UTSW 10 20267257 missense unknown
R6919:Map7 UTSW 10 20171082 start gained probably benign
X0022:Map7 UTSW 10 20269582 missense unknown
Predicted Primers PCR Primer
(F):5'- TCTATGGCCCCAAGCTTCTG -3'
(R):5'- AAACAACCATTCATCCTCTCTTGGG -3'

Sequencing Primer
(F):5'- CAAGCTTCTGTTTTATTTCAAAGCC -3'
(R):5'- GTACCAGCTCTGACGACCG -3'
Posted On2018-05-24