Incidental Mutation 'R6446:Cbx2'
ID519199
Institutional Source Beutler Lab
Gene Symbol Cbx2
Ensembl Gene ENSMUSG00000025577
Gene Namechromobox 2
SynonymsM33
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.750) question?
Stock #R6446 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location119022962-119031270 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 119027926 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 106 (S106T)
Ref Sequence ENSEMBL: ENSMUSP00000026662 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026662]
Predicted Effect probably benign
Transcript: ENSMUST00000026662
AA Change: S106T

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000026662
Gene: ENSMUSG00000025577
AA Change: S106T

DomainStartEndE-ValueType
CHROMO 11 63 5.74e-17 SMART
AT_hook 74 86 2.05e-1 SMART
low complexity region 102 132 N/A INTRINSIC
low complexity region 197 210 N/A INTRINSIC
low complexity region 301 318 N/A INTRINSIC
low complexity region 452 465 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139746
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 93.9%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: This gene encodes a component of the polycomb multiprotein complex, which is required to maintain the transcriptionally repressive state of many genes throughout development via chromatin remodeling and modification of histones. Disruption of this gene in results in male-to-female gonadal sex reversal. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mutations cause malformations of the axial skeletal, reduced viability, poor growth and male to female sex reversal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp13a3 A G 16: 30,361,869 L114P probably benign Het
Blm GCCTCCTCCTCCTCCTCCTCCTCCTCCTCC GCCTCCTCCTCCTCCTCCTCCTCCTCC 7: 80,512,904 probably benign Het
Catsperg1 T C 7: 29,206,567 I196V probably benign Het
Ccar2 T A 14: 70,143,069 E354V probably benign Het
Ccr1 A G 9: 123,964,106 I129T probably damaging Het
Cdkl2 T A 5: 92,033,217 I188F probably damaging Het
Cep350 T C 1: 155,862,154 N2648D probably benign Het
Chtf18 A G 17: 25,721,244 S658P probably benign Het
Csnka2ip G A 16: 64,479,381 Q207* probably null Het
Dennd5a A G 7: 109,894,666 L1253P probably damaging Het
Dennd6a T A 14: 26,629,534 I374K probably damaging Het
Dut T C 2: 125,251,019 probably null Het
Gcm1 T C 9: 78,059,783 Y95H probably benign Het
Gm4951 A G 18: 60,245,768 D125G probably damaging Het
Grid2 A T 6: 64,345,593 I526F probably damaging Het
Hectd4 T A 5: 121,334,375 Y2725N possibly damaging Het
Helq A T 5: 100,768,384 N907K possibly damaging Het
Hpse G A 5: 100,695,569 Q246* probably null Het
Kcnj15 C T 16: 95,296,259 H247Y probably benign Het
Kif27 C A 13: 58,345,716 V138F probably damaging Het
Map7 T G 10: 20,278,233 D698E unknown Het
Mtmr11 A T 3: 96,171,188 S687C probably benign Het
Ncbp2 CGTCTGGATG CG 16: 31,956,343 probably null Het
Nup210l G A 3: 90,172,068 G953E probably damaging Het
Olfr297 T A 7: 86,527,102 I115N possibly damaging Het
Piezo2 G T 18: 63,086,607 P792T probably damaging Het
Pld3 T C 7: 27,537,731 D241G probably damaging Het
Prss35 G T 9: 86,755,653 V159F probably damaging Het
Rimbp3 A T 16: 17,212,929 M1406L probably benign Het
Serpina3g T C 12: 104,239,082 F27L probably damaging Het
Setd1b G A 5: 123,161,799 probably benign Het
Sh3glb1 T C 3: 144,705,605 K13E probably damaging Het
Slc29a1 A T 17: 45,589,245 I217N possibly damaging Het
Spag17 A T 3: 100,103,132 T1981S probably benign Het
Svil A C 18: 5,057,323 E590D probably benign Het
Synm A G 7: 67,734,966 S541P probably damaging Het
Vmn2r108 A T 17: 20,472,347 Y82* probably null Het
Other mutations in Cbx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1005:Cbx2 UTSW 11 119028574 missense probably benign
R1629:Cbx2 UTSW 11 119028980 missense probably damaging 0.99
R1954:Cbx2 UTSW 11 119028340 missense probably damaging 0.99
R1962:Cbx2 UTSW 11 119028569 missense possibly damaging 0.76
R4674:Cbx2 UTSW 11 119029109 missense probably damaging 1.00
R4675:Cbx2 UTSW 11 119029109 missense probably damaging 1.00
R5558:Cbx2 UTSW 11 119028949 missense probably benign 0.01
R6550:Cbx2 UTSW 11 119029025 missense possibly damaging 0.63
R6610:Cbx2 UTSW 11 119024210 missense probably damaging 1.00
R6622:Cbx2 UTSW 11 119029135 missense probably damaging 0.99
R7095:Cbx2 UTSW 11 119028059 missense probably damaging 1.00
R7132:Cbx2 UTSW 11 119023121 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- GCTTACCACTGAACGGGTTTC -3'
(R):5'- TGGTCTTTAGCACCTTGGCC -3'

Sequencing Primer
(F):5'- CGCCCTTCTCCACAAGCATG -3'
(R):5'- TAGAGGCTTGCGTCCCC -3'
Posted On2018-05-24