Incidental Mutation 'R6446:Serpina3g'
ID519200
Institutional Source Beutler Lab
Gene Symbol Serpina3g
Ensembl Gene ENSMUSG00000041481
Gene Nameserine (or cysteine) peptidase inhibitor, clade A, member 3G
SynonymsSpi2-1, 2A2, Spi2A, Spi2/eb.1, alpha-1 antiproteinase,, alpha-1 antiproteinase
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.045) question?
Stock #R6446 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location104236245-104241939 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 104239082 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 27 (F27L)
Ref Sequence ENSEMBL: ENSMUSP00000129633 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043315] [ENSMUST00000170628] [ENSMUST00000171916]
Predicted Effect probably damaging
Transcript: ENSMUST00000043315
AA Change: F27L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000041250
Gene: ENSMUSG00000041481
AA Change: F27L

DomainStartEndE-ValueType
SERPIN 1 215 1.09e-43 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000170628
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171065
Predicted Effect probably damaging
Transcript: ENSMUST00000171916
AA Change: F27L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129633
Gene: ENSMUSG00000041481
AA Change: F27L

DomainStartEndE-ValueType
Pfam:Serpin 1 101 1.3e-31 PFAM
Meta Mutation Damage Score 0.358 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 93.9%
Validation Efficiency 97% (36/37)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired memory T cell homeostatic proliferation, decreased CD8+ T cells and antigen-specific CD8+ T cells after LCMV infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp13a3 A G 16: 30,361,869 L114P probably benign Het
Blm GCCTCCTCCTCCTCCTCCTCCTCCTCCTCC GCCTCCTCCTCCTCCTCCTCCTCCTCC 7: 80,512,904 probably benign Het
Catsperg1 T C 7: 29,206,567 I196V probably benign Het
Cbx2 T A 11: 119,027,926 S106T probably benign Het
Ccar2 T A 14: 70,143,069 E354V probably benign Het
Ccr1 A G 9: 123,964,106 I129T probably damaging Het
Cdkl2 T A 5: 92,033,217 I188F probably damaging Het
Cep350 T C 1: 155,862,154 N2648D probably benign Het
Chtf18 A G 17: 25,721,244 S658P probably benign Het
Csnka2ip G A 16: 64,479,381 Q207* probably null Het
Dennd5a A G 7: 109,894,666 L1253P probably damaging Het
Dennd6a T A 14: 26,629,534 I374K probably damaging Het
Dut T C 2: 125,251,019 probably null Het
Gcm1 T C 9: 78,059,783 Y95H probably benign Het
Gm4951 A G 18: 60,245,768 D125G probably damaging Het
Grid2 A T 6: 64,345,593 I526F probably damaging Het
Hectd4 T A 5: 121,334,375 Y2725N possibly damaging Het
Helq A T 5: 100,768,384 N907K possibly damaging Het
Hpse G A 5: 100,695,569 Q246* probably null Het
Kcnj15 C T 16: 95,296,259 H247Y probably benign Het
Kif27 C A 13: 58,345,716 V138F probably damaging Het
Map7 T G 10: 20,278,233 D698E unknown Het
Mtmr11 A T 3: 96,171,188 S687C probably benign Het
Ncbp2 CGTCTGGATG CG 16: 31,956,343 probably null Het
Nup210l G A 3: 90,172,068 G953E probably damaging Het
Olfr297 T A 7: 86,527,102 I115N possibly damaging Het
Piezo2 G T 18: 63,086,607 P792T probably damaging Het
Pld3 T C 7: 27,537,731 D241G probably damaging Het
Prss35 G T 9: 86,755,653 V159F probably damaging Het
Rimbp3 A T 16: 17,212,929 M1406L probably benign Het
Setd1b G A 5: 123,161,799 probably benign Het
Sh3glb1 T C 3: 144,705,605 K13E probably damaging Het
Slc29a1 A T 17: 45,589,245 I217N possibly damaging Het
Spag17 A T 3: 100,103,132 T1981S probably benign Het
Svil A C 18: 5,057,323 E590D probably benign Het
Synm A G 7: 67,734,966 S541P probably damaging Het
Vmn2r108 A T 17: 20,472,347 Y82* probably null Het
Other mutations in Serpina3g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02629:Serpina3g APN 12 104241178 missense probably damaging 0.99
IGL02663:Serpina3g APN 12 104239140 missense possibly damaging 0.94
R0047:Serpina3g UTSW 12 104240284 missense possibly damaging 0.69
R0525:Serpina3g UTSW 12 104238339 missense probably damaging 1.00
R0702:Serpina3g UTSW 12 104241253 missense probably damaging 0.96
R1163:Serpina3g UTSW 12 104239292 missense possibly damaging 0.84
R1595:Serpina3g UTSW 12 104239272 missense probably benign 0.16
R1908:Serpina3g UTSW 12 104241277 missense probably damaging 0.96
R2089:Serpina3g UTSW 12 104239158 missense probably damaging 1.00
R2091:Serpina3g UTSW 12 104239158 missense probably damaging 1.00
R2091:Serpina3g UTSW 12 104239158 missense probably damaging 1.00
R2403:Serpina3g UTSW 12 104241162 missense probably damaging 1.00
R4165:Serpina3g UTSW 12 104240287 missense probably benign 0.00
R4466:Serpina3g UTSW 12 104237923 splice site probably benign
R4669:Serpina3g UTSW 12 104239220 missense probably damaging 1.00
R4735:Serpina3g UTSW 12 104239113 missense probably damaging 1.00
R5423:Serpina3g UTSW 12 104237994 utr 5 prime probably benign
R5552:Serpina3g UTSW 12 104240336 missense probably damaging 0.96
R5605:Serpina3g UTSW 12 104241040 missense probably damaging 1.00
R6384:Serpina3g UTSW 12 104240396 missense probably null 0.34
R7100:Serpina3g UTSW 12 104238311 start gained probably benign
Predicted Primers PCR Primer
(F):5'- ACTACTAAGGGACACTGTGCTG -3'
(R):5'- GGGCTTCAGAGAGTTCTTCCAC -3'

Sequencing Primer
(F):5'- TACTAAGGGACACTGTGCTGTTGAAG -3'
(R):5'- AGAGAGTTCTTCCACTTCCTCAGG -3'
Posted On2018-05-24