Incidental Mutation 'R6446:Ccar2'
ID519203
Institutional Source Beutler Lab
Gene Symbol Ccar2
Ensembl Gene ENSMUSG00000033712
Gene Namecell cycle activator and apoptosis regulator 2
Synonyms2610301G19Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.383) question?
Stock #R6446 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location70138164-70153811 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 70143069 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 354 (E354V)
Ref Sequence ENSEMBL: ENSMUSP00000036924 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022680] [ENSMUST00000035612]
Predicted Effect probably benign
Transcript: ENSMUST00000022680
SMART Domains Protein: ENSMUSP00000022680
Gene: ENSMUSG00000022089

DomainStartEndE-ValueType
BAR 5 225 2.05e-55 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000035612
AA Change: E354V

PolyPhen 2 Score 0.306 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000036924
Gene: ENSMUSG00000033712
AA Change: E354V

DomainStartEndE-ValueType
low complexity region 23 37 N/A INTRINSIC
Pfam:S1-like 55 112 1.3e-29 PFAM
DBC1 339 462 8.48e-73 SMART
low complexity region 496 507 N/A INTRINSIC
low complexity region 534 545 N/A INTRINSIC
low complexity region 563 601 N/A INTRINSIC
low complexity region 627 640 N/A INTRINSIC
low complexity region 647 660 N/A INTRINSIC
SCOP:d2mysb_ 703 747 2e-3 SMART
Blast:HDc 704 758 7e-7 BLAST
coiled coil region 828 898 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227589
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 93.9%
Validation Efficiency 97% (36/37)
MGI Phenotype PHENOTYPE: Homozygous null mice on a high fat diet are resistant to hepatic steatosis and associated liver inflammation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp13a3 A G 16: 30,361,869 L114P probably benign Het
Blm GCCTCCTCCTCCTCCTCCTCCTCCTCCTCC GCCTCCTCCTCCTCCTCCTCCTCCTCC 7: 80,512,904 probably benign Het
Catsperg1 T C 7: 29,206,567 I196V probably benign Het
Cbx2 T A 11: 119,027,926 S106T probably benign Het
Ccr1 A G 9: 123,964,106 I129T probably damaging Het
Cdkl2 T A 5: 92,033,217 I188F probably damaging Het
Cep350 T C 1: 155,862,154 N2648D probably benign Het
Chtf18 A G 17: 25,721,244 S658P probably benign Het
Csnka2ip G A 16: 64,479,381 Q207* probably null Het
Dennd5a A G 7: 109,894,666 L1253P probably damaging Het
Dennd6a T A 14: 26,629,534 I374K probably damaging Het
Dut T C 2: 125,251,019 probably null Het
Gcm1 T C 9: 78,059,783 Y95H probably benign Het
Gm4951 A G 18: 60,245,768 D125G probably damaging Het
Grid2 A T 6: 64,345,593 I526F probably damaging Het
Hectd4 T A 5: 121,334,375 Y2725N possibly damaging Het
Helq A T 5: 100,768,384 N907K possibly damaging Het
Hpse G A 5: 100,695,569 Q246* probably null Het
Kcnj15 C T 16: 95,296,259 H247Y probably benign Het
Kif27 C A 13: 58,345,716 V138F probably damaging Het
Map7 T G 10: 20,278,233 D698E unknown Het
Mtmr11 A T 3: 96,171,188 S687C probably benign Het
Ncbp2 CGTCTGGATG CG 16: 31,956,343 probably null Het
Nup210l G A 3: 90,172,068 G953E probably damaging Het
Olfr297 T A 7: 86,527,102 I115N possibly damaging Het
Piezo2 G T 18: 63,086,607 P792T probably damaging Het
Pld3 T C 7: 27,537,731 D241G probably damaging Het
Prss35 G T 9: 86,755,653 V159F probably damaging Het
Rimbp3 A T 16: 17,212,929 M1406L probably benign Het
Serpina3g T C 12: 104,239,082 F27L probably damaging Het
Setd1b G A 5: 123,161,799 probably benign Het
Sh3glb1 T C 3: 144,705,605 K13E probably damaging Het
Slc29a1 A T 17: 45,589,245 I217N possibly damaging Het
Spag17 A T 3: 100,103,132 T1981S probably benign Het
Svil A C 18: 5,057,323 E590D probably benign Het
Synm A G 7: 67,734,966 S541P probably damaging Het
Vmn2r108 A T 17: 20,472,347 Y82* probably null Het
Other mutations in Ccar2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Ccar2 APN 14 70142531 nonsense probably null
IGL01351:Ccar2 APN 14 70145862 missense probably benign 0.03
IGL01450:Ccar2 APN 14 70139751 splice site probably benign
IGL02306:Ccar2 APN 14 70142022 missense probably benign 0.01
IGL03403:Ccar2 APN 14 70140068 missense probably damaging 1.00
R0332:Ccar2 UTSW 14 70141935 splice site probably benign
R0502:Ccar2 UTSW 14 70140982 missense probably benign 0.00
R0827:Ccar2 UTSW 14 70139838 missense probably benign 0.00
R1022:Ccar2 UTSW 14 70140515 missense probably damaging 1.00
R1024:Ccar2 UTSW 14 70140515 missense probably damaging 1.00
R1160:Ccar2 UTSW 14 70139769 missense probably benign 0.42
R1258:Ccar2 UTSW 14 70152673 missense probably benign 0.24
R1389:Ccar2 UTSW 14 70140109 missense possibly damaging 0.46
R1532:Ccar2 UTSW 14 70142956 missense probably benign 0.01
R1870:Ccar2 UTSW 14 70140497 missense probably damaging 1.00
R2127:Ccar2 UTSW 14 70139651 missense probably benign 0.33
R4233:Ccar2 UTSW 14 70151091 missense possibly damaging 0.76
R4569:Ccar2 UTSW 14 70151910 unclassified probably null
R4799:Ccar2 UTSW 14 70139554 missense probably damaging 0.99
R5026:Ccar2 UTSW 14 70142502 missense possibly damaging 0.89
R5435:Ccar2 UTSW 14 70139327 missense probably damaging 1.00
R5893:Ccar2 UTSW 14 70151351 missense probably benign 0.28
R6594:Ccar2 UTSW 14 70140476 missense probably damaging 1.00
R6648:Ccar2 UTSW 14 70139225 missense probably benign 0.29
R7103:Ccar2 UTSW 14 70141977 missense probably damaging 0.99
V5088:Ccar2 UTSW 14 70151289 missense probably damaging 0.99
V5622:Ccar2 UTSW 14 70151289 missense probably damaging 0.99
V5622:Ccar2 UTSW 14 70151289 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCTGGGTTCTCAGTCATCTGTG -3'
(R):5'- TCAGCAGCTAGGCTTCTGTG -3'

Sequencing Primer
(F):5'- CTCAGTCATCTGTGAGCAGTTAG -3'
(R):5'- GGAGCTGAAGGCCCTAACTTTATAC -3'
Posted On2018-05-24