Incidental Mutation 'R6446:Csnka2ip'
ID519207
Institutional Source Beutler Lab
Gene Symbol Csnka2ip
Ensembl Gene ENSMUSG00000068167
Gene Namecasein kinase 2, alpha prime interacting protein
SynonymsCkt2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R6446 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location64477810-64602408 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 64479381 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 207 (Q207*)
Ref Sequence ENSEMBL: ENSMUSP00000147880 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089279] [ENSMUST00000209382]
Predicted Effect probably benign
Transcript: ENSMUST00000089279
SMART Domains Protein: ENSMUSP00000086692
Gene: ENSMUSG00000068167

DomainStartEndE-ValueType
low complexity region 164 182 N/A INTRINSIC
low complexity region 186 201 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000209382
AA Change: Q207*
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 93.9%
Validation Efficiency 97% (36/37)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp13a3 A G 16: 30,361,869 L114P probably benign Het
Blm GCCTCCTCCTCCTCCTCCTCCTCCTCCTCC GCCTCCTCCTCCTCCTCCTCCTCCTCC 7: 80,512,904 probably benign Het
Catsperg1 T C 7: 29,206,567 I196V probably benign Het
Cbx2 T A 11: 119,027,926 S106T probably benign Het
Ccar2 T A 14: 70,143,069 E354V probably benign Het
Ccr1 A G 9: 123,964,106 I129T probably damaging Het
Cdkl2 T A 5: 92,033,217 I188F probably damaging Het
Cep350 T C 1: 155,862,154 N2648D probably benign Het
Chtf18 A G 17: 25,721,244 S658P probably benign Het
Dennd5a A G 7: 109,894,666 L1253P probably damaging Het
Dennd6a T A 14: 26,629,534 I374K probably damaging Het
Dut T C 2: 125,251,019 probably null Het
Gcm1 T C 9: 78,059,783 Y95H probably benign Het
Gm4951 A G 18: 60,245,768 D125G probably damaging Het
Grid2 A T 6: 64,345,593 I526F probably damaging Het
Hectd4 T A 5: 121,334,375 Y2725N possibly damaging Het
Helq A T 5: 100,768,384 N907K possibly damaging Het
Hpse G A 5: 100,695,569 Q246* probably null Het
Kcnj15 C T 16: 95,296,259 H247Y probably benign Het
Kif27 C A 13: 58,345,716 V138F probably damaging Het
Map7 T G 10: 20,278,233 D698E unknown Het
Mtmr11 A T 3: 96,171,188 S687C probably benign Het
Ncbp2 CGTCTGGATG CG 16: 31,956,343 probably null Het
Nup210l G A 3: 90,172,068 G953E probably damaging Het
Olfr297 T A 7: 86,527,102 I115N possibly damaging Het
Piezo2 G T 18: 63,086,607 P792T probably damaging Het
Pld3 T C 7: 27,537,731 D241G probably damaging Het
Prss35 G T 9: 86,755,653 V159F probably damaging Het
Rimbp3 A T 16: 17,212,929 M1406L probably benign Het
Serpina3g T C 12: 104,239,082 F27L probably damaging Het
Setd1b G A 5: 123,161,799 probably benign Het
Sh3glb1 T C 3: 144,705,605 K13E probably damaging Het
Slc29a1 A T 17: 45,589,245 I217N possibly damaging Het
Spag17 A T 3: 100,103,132 T1981S probably benign Het
Svil A C 18: 5,057,323 E590D probably benign Het
Synm A G 7: 67,734,966 S541P probably damaging Het
Vmn2r108 A T 17: 20,472,347 Y82* probably null Het
Other mutations in Csnka2ip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02039:Csnka2ip APN 16 64478594 missense probably damaging 0.99
IGL02677:Csnka2ip APN 16 64478312 missense probably damaging 0.99
R0593:Csnka2ip UTSW 16 64478612 missense probably damaging 0.99
R1075:Csnka2ip UTSW 16 64477947 nonsense probably null
R1698:Csnka2ip UTSW 16 64478059 nonsense probably null
R1815:Csnka2ip UTSW 16 64478492 missense probably benign
R6709:Csnka2ip UTSW 16 64478569 missense possibly damaging 0.92
R6937:Csnka2ip UTSW 16 64478695 utr 5 prime probably benign
R6999:Csnka2ip UTSW 16 64478570 missense unknown
R7013:Csnka2ip UTSW 16 64478417 missense unknown
R7103:Csnka2ip UTSW 16 64478757 missense unknown
Predicted Primers PCR Primer
(F):5'- TCAGAGGCTTGCTACAGTCG -3'
(R):5'- AGTTCGAGATCAAGGTTACTCC -3'

Sequencing Primer
(F):5'- CTACAGTCGGGTAGTGGTGAATTAC -3'
(R):5'- GACGCAGACATCATCAAGTATTG -3'
Posted On2018-05-24