Incidental Mutation 'R6446:Kcnj15'
ID519208
Institutional Source Beutler Lab
Gene Symbol Kcnj15
Ensembl Gene ENSMUSG00000062609
Gene Namepotassium inwardly-rectifying channel, subfamily J, member 15
SynonymsKir4.2, IRKK, 4930414N08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6446 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location95257558-95300260 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 95296259 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 247 (H247Y)
Ref Sequence ENSEMBL: ENSMUSP00000109493 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037154] [ENSMUST00000113854] [ENSMUST00000113855] [ENSMUST00000113856] [ENSMUST00000113858] [ENSMUST00000113859] [ENSMUST00000113861] [ENSMUST00000113862] [ENSMUST00000125847] [ENSMUST00000134166] [ENSMUST00000138329] [ENSMUST00000140222] [ENSMUST00000152516]
Predicted Effect probably benign
Transcript: ENSMUST00000037154
AA Change: H247Y

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000045218
Gene: ENSMUSG00000062609
AA Change: H247Y

DomainStartEndE-ValueType
Pfam:IRK 57 384 4.4e-139 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113854
AA Change: H220Y

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000109485
Gene: ENSMUSG00000062609
AA Change: H220Y

DomainStartEndE-ValueType
Pfam:IRK 30 365 2.5e-150 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113855
AA Change: H220Y

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000109486
Gene: ENSMUSG00000062609
AA Change: H220Y

DomainStartEndE-ValueType
Pfam:IRK 30 365 2.5e-150 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113856
AA Change: H220Y

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000109487
Gene: ENSMUSG00000062609
AA Change: H220Y

DomainStartEndE-ValueType
Pfam:IRK 30 365 2.5e-150 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113858
AA Change: H220Y

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000109489
Gene: ENSMUSG00000062609
AA Change: H220Y

DomainStartEndE-ValueType
Pfam:IRK 57 392 4.9e-150 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113859
AA Change: H247Y

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000109490
Gene: ENSMUSG00000062609
AA Change: H247Y

DomainStartEndE-ValueType
Pfam:IRK 57 392 4.9e-150 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113861
AA Change: H247Y

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000109492
Gene: ENSMUSG00000062609
AA Change: H247Y

DomainStartEndE-ValueType
Pfam:IRK 57 392 4.9e-150 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113862
AA Change: H247Y

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000109493
Gene: ENSMUSG00000062609
AA Change: H247Y

DomainStartEndE-ValueType
Pfam:IRK 57 392 4.9e-150 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125847
Predicted Effect probably benign
Transcript: ENSMUST00000134166
SMART Domains Protein: ENSMUSP00000118992
Gene: ENSMUSG00000062609

DomainStartEndE-ValueType
Pfam:IRK 57 173 8.9e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138329
Predicted Effect probably benign
Transcript: ENSMUST00000140222
Predicted Effect probably benign
Transcript: ENSMUST00000152516
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232605
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232622
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 93.9%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Potassium channels are present in most mammalian cells, where they participate in a wide range of physiologic responses. The protein encoded by this gene is an integral membrane protein and inward-rectifier type potassium channel. The encoded protein has a greater tendency to allow potassium to flow into a cell rather than out of a cell. Eight transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Feb 2013]
PHENOTYPE: Homozygous knockout mice exhibited impaired balance/coordination in a high-throughput screen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp13a3 A G 16: 30,361,869 L114P probably benign Het
Blm GCCTCCTCCTCCTCCTCCTCCTCCTCCTCC GCCTCCTCCTCCTCCTCCTCCTCCTCC 7: 80,512,904 probably benign Het
Catsperg1 T C 7: 29,206,567 I196V probably benign Het
Cbx2 T A 11: 119,027,926 S106T probably benign Het
Ccar2 T A 14: 70,143,069 E354V probably benign Het
Ccr1 A G 9: 123,964,106 I129T probably damaging Het
Cdkl2 T A 5: 92,033,217 I188F probably damaging Het
Cep350 T C 1: 155,862,154 N2648D probably benign Het
Chtf18 A G 17: 25,721,244 S658P probably benign Het
Csnka2ip G A 16: 64,479,381 Q207* probably null Het
Dennd5a A G 7: 109,894,666 L1253P probably damaging Het
Dennd6a T A 14: 26,629,534 I374K probably damaging Het
Dut T C 2: 125,251,019 probably null Het
Gcm1 T C 9: 78,059,783 Y95H probably benign Het
Gm4951 A G 18: 60,245,768 D125G probably damaging Het
Grid2 A T 6: 64,345,593 I526F probably damaging Het
Hectd4 T A 5: 121,334,375 Y2725N possibly damaging Het
Helq A T 5: 100,768,384 N907K possibly damaging Het
Hpse G A 5: 100,695,569 Q246* probably null Het
Kif27 C A 13: 58,345,716 V138F probably damaging Het
Map7 T G 10: 20,278,233 D698E unknown Het
Mtmr11 A T 3: 96,171,188 S687C probably benign Het
Ncbp2 CGTCTGGATG CG 16: 31,956,343 probably null Het
Nup210l G A 3: 90,172,068 G953E probably damaging Het
Olfr297 T A 7: 86,527,102 I115N possibly damaging Het
Piezo2 G T 18: 63,086,607 P792T probably damaging Het
Pld3 T C 7: 27,537,731 D241G probably damaging Het
Prss35 G T 9: 86,755,653 V159F probably damaging Het
Rimbp3 A T 16: 17,212,929 M1406L probably benign Het
Serpina3g T C 12: 104,239,082 F27L probably damaging Het
Setd1b G A 5: 123,161,799 probably benign Het
Sh3glb1 T C 3: 144,705,605 K13E probably damaging Het
Slc29a1 A T 17: 45,589,245 I217N possibly damaging Het
Spag17 A T 3: 100,103,132 T1981S probably benign Het
Svil A C 18: 5,057,323 E590D probably benign Het
Synm A G 7: 67,734,966 S541P probably damaging Het
Vmn2r108 A T 17: 20,472,347 Y82* probably null Het
Other mutations in Kcnj15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00733:Kcnj15 APN 16 95296463 missense probably damaging 1.00
IGL03096:Kcnj15 APN 16 95296434 missense probably damaging 1.00
R1117:Kcnj15 UTSW 16 95295625 missense probably benign 0.28
R3911:Kcnj15 UTSW 16 95296470 missense probably damaging 1.00
R3913:Kcnj15 UTSW 16 95296470 missense probably damaging 1.00
R3928:Kcnj15 UTSW 16 95296509 missense possibly damaging 0.95
R4155:Kcnj15 UTSW 16 95296307 nonsense probably null
R4613:Kcnj15 UTSW 16 95295794 missense probably damaging 1.00
R5334:Kcnj15 UTSW 16 95296649 missense probably damaging 1.00
R6151:Kcnj15 UTSW 16 95295668 nonsense probably null
R6334:Kcnj15 UTSW 16 95296236 missense probably damaging 1.00
R6727:Kcnj15 UTSW 16 95296334 missense probably damaging 1.00
R7070:Kcnj15 UTSW 16 95295831 missense probably damaging 1.00
Z1088:Kcnj15 UTSW 16 95296119 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTCATCACCACATTGATTGAG -3'
(R):5'- GCGTTGAGAAGTACCACCAG -3'

Sequencing Primer
(F):5'- ATTGAGATCTTCATTACGGGGACC -3'
(R):5'- GTTGAGAAGTACCACCAGCTCAAAC -3'
Posted On2018-05-24