Incidental Mutation 'R6446:Chtf18'
ID519210
Institutional Source Beutler Lab
Gene Symbol Chtf18
Ensembl Gene ENSMUSG00000019214
Gene NameCTF18, chromosome transmission fidelity factor 18
Synonyms6030457M03Rik, CTF18
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.358) question?
Stock #R6446 (G1)
Quality Score213.009
Status Validated
Chromosome17
Chromosomal Location25718926-25727419 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 25721244 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 658 (S658P)
Ref Sequence ENSEMBL: ENSMUSP00000043896 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048054] [ENSMUST00000115108] [ENSMUST00000167940] [ENSMUST00000170070] [ENSMUST00000170575] [ENSMUST00000172002]
Predicted Effect probably benign
Transcript: ENSMUST00000048054
AA Change: S658P

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000043896
Gene: ENSMUSG00000019214
AA Change: S658P

DomainStartEndE-ValueType
low complexity region 20 30 N/A INTRINSIC
low complexity region 73 84 N/A INTRINSIC
low complexity region 117 130 N/A INTRINSIC
low complexity region 154 168 N/A INTRINSIC
coiled coil region 228 255 N/A INTRINSIC
low complexity region 299 310 N/A INTRINSIC
low complexity region 343 354 N/A INTRINSIC
AAA 361 518 1.99e-11 SMART
low complexity region 646 661 N/A INTRINSIC
Blast:AAA 728 850 7e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000115108
SMART Domains Protein: ENSMUSP00000110760
Gene: ENSMUSG00000025739

DomainStartEndE-ValueType
G_gamma 3 67 1.32e-16 SMART
GGL 6 67 2.09e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167940
SMART Domains Protein: ENSMUSP00000131349
Gene: ENSMUSG00000019214

DomainStartEndE-ValueType
low complexity region 8 20 N/A INTRINSIC
Blast:AAA 21 107 9e-11 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168060
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168914
Predicted Effect probably benign
Transcript: ENSMUST00000169767
Predicted Effect probably benign
Transcript: ENSMUST00000170070
SMART Domains Protein: ENSMUSP00000131768
Gene: ENSMUSG00000019214

DomainStartEndE-ValueType
low complexity region 20 31 N/A INTRINSIC
low complexity region 74 85 N/A INTRINSIC
low complexity region 118 131 N/A INTRINSIC
low complexity region 155 169 N/A INTRINSIC
coiled coil region 229 256 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170575
SMART Domains Protein: ENSMUSP00000131366
Gene: ENSMUSG00000019214

DomainStartEndE-ValueType
low complexity region 20 31 N/A INTRINSIC
low complexity region 74 85 N/A INTRINSIC
low complexity region 118 131 N/A INTRINSIC
low complexity region 155 169 N/A INTRINSIC
coiled coil region 229 256 N/A INTRINSIC
low complexity region 300 311 N/A INTRINSIC
low complexity region 344 355 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172002
SMART Domains Protein: ENSMUSP00000131648
Gene: ENSMUSG00000025739

DomainStartEndE-ValueType
G_gamma 3 67 1.32e-16 SMART
GGL 6 67 2.09e-9 SMART
Meta Mutation Damage Score 0.02 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 93.9%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is a component of a replication factor C (RFC) complex, which loads proliferating cell nuclear antigen (PCNA) on to DNA during the S phase of cell cycle. The encoded protein may interact with other proteins, including RFC complex 3, to form a clamp loader complex that plays a role in sister chromatid cohesion during metaphase-anaphase transition. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit partial prenatal lethality, reduced body and testis weight, defective male meiosis, impaired spermatogenesis, oligozoospermia, and reduced male fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp13a3 A G 16: 30,361,869 L114P probably benign Het
Blm GCCTCCTCCTCCTCCTCCTCCTCCTCCTCC GCCTCCTCCTCCTCCTCCTCCTCCTCC 7: 80,512,904 probably benign Het
Catsperg1 T C 7: 29,206,567 I196V probably benign Het
Cbx2 T A 11: 119,027,926 S106T probably benign Het
Ccar2 T A 14: 70,143,069 E354V probably benign Het
Ccr1 A G 9: 123,964,106 I129T probably damaging Het
Cdkl2 T A 5: 92,033,217 I188F probably damaging Het
Cep350 T C 1: 155,862,154 N2648D probably benign Het
Csnka2ip G A 16: 64,479,381 Q207* probably null Het
Dennd5a A G 7: 109,894,666 L1253P probably damaging Het
Dennd6a T A 14: 26,629,534 I374K probably damaging Het
Dut T C 2: 125,251,019 probably null Het
Gcm1 T C 9: 78,059,783 Y95H probably benign Het
Gm4951 A G 18: 60,245,768 D125G probably damaging Het
Grid2 A T 6: 64,345,593 I526F probably damaging Het
Hectd4 T A 5: 121,334,375 Y2725N possibly damaging Het
Helq A T 5: 100,768,384 N907K possibly damaging Het
Hpse G A 5: 100,695,569 Q246* probably null Het
Kcnj15 C T 16: 95,296,259 H247Y probably benign Het
Kif27 C A 13: 58,345,716 V138F probably damaging Het
Map7 T G 10: 20,278,233 D698E unknown Het
Mtmr11 A T 3: 96,171,188 S687C probably benign Het
Ncbp2 CGTCTGGATG CG 16: 31,956,343 probably null Het
Nup210l G A 3: 90,172,068 G953E probably damaging Het
Olfr297 T A 7: 86,527,102 I115N possibly damaging Het
Piezo2 G T 18: 63,086,607 P792T probably damaging Het
Pld3 T C 7: 27,537,731 D241G probably damaging Het
Prss35 G T 9: 86,755,653 V159F probably damaging Het
Rimbp3 A T 16: 17,212,929 M1406L probably benign Het
Serpina3g T C 12: 104,239,082 F27L probably damaging Het
Setd1b G A 5: 123,161,799 probably benign Het
Sh3glb1 T C 3: 144,705,605 K13E probably damaging Het
Slc29a1 A T 17: 45,589,245 I217N possibly damaging Het
Spag17 A T 3: 100,103,132 T1981S probably benign Het
Svil A C 18: 5,057,323 E590D probably benign Het
Synm A G 7: 67,734,966 S541P probably damaging Het
Vmn2r108 A T 17: 20,472,347 Y82* probably null Het
Other mutations in Chtf18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00973:Chtf18 APN 17 25722116 missense probably benign 0.32
IGL02117:Chtf18 APN 17 25722203 missense possibly damaging 0.63
IGL03034:Chtf18 APN 17 25727346 utr 5 prime probably benign
IGL03051:Chtf18 APN 17 25720964 missense probably damaging 1.00
IGL03164:Chtf18 APN 17 25726842 missense probably benign 0.24
R0046:Chtf18 UTSW 17 25723460 missense probably benign 0.06
R0129:Chtf18 UTSW 17 25727311 nonsense probably null
R1122:Chtf18 UTSW 17 25724623 missense probably damaging 1.00
R1302:Chtf18 UTSW 17 25719158 missense probably damaging 1.00
R1487:Chtf18 UTSW 17 25720609 missense probably benign 0.00
R1614:Chtf18 UTSW 17 25727090 missense probably benign 0.00
R1820:Chtf18 UTSW 17 25725939 missense probably damaging 1.00
R4051:Chtf18 UTSW 17 25719194 missense probably damaging 0.98
R4357:Chtf18 UTSW 17 25719132 missense probably benign 0.09
R4529:Chtf18 UTSW 17 25720618 missense probably damaging 1.00
R4804:Chtf18 UTSW 17 25719257 missense probably benign
R4975:Chtf18 UTSW 17 25724566 missense possibly damaging 0.72
R5154:Chtf18 UTSW 17 25723720 missense probably damaging 1.00
R6113:Chtf18 UTSW 17 25722867 missense probably damaging 1.00
R6118:Chtf18 UTSW 17 25719159 missense probably damaging 1.00
R7057:Chtf18 UTSW 17 25721126 missense possibly damaging 0.49
R7095:Chtf18 UTSW 17 25722678 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGAAAGTGATTCGTGGCAC -3'
(R):5'- AGGGCCTTCATTAGACTAGTAGG -3'

Sequencing Primer
(F):5'- TGGCACATGGCTGGAGG -3'
(R):5'- AGACTAGTAGGTCCTTCCCTGG -3'
Posted On2018-05-24