Incidental Mutation 'R6446:Gm4951'
ID519213
Institutional Source Beutler Lab
Gene Symbol Gm4951
Ensembl Gene ENSMUSG00000073555
Gene Namepredicted gene 4951
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6446 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location60212080-60247820 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 60245768 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 125 (D125G)
Ref Sequence ENSEMBL: ENSMUSP00000031549 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031549]
Predicted Effect probably damaging
Transcript: ENSMUST00000031549
AA Change: D125G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031549
Gene: ENSMUSG00000073555
AA Change: D125G

DomainStartEndE-ValueType
Pfam:IIGP 34 402 4.8e-157 PFAM
Pfam:MMR_HSR1 70 198 2.8e-8 PFAM
Meta Mutation Damage Score 0.41 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 93.9%
Validation Efficiency 97% (36/37)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp13a3 A G 16: 30,361,869 L114P probably benign Het
Blm GCCTCCTCCTCCTCCTCCTCCTCCTCCTCC GCCTCCTCCTCCTCCTCCTCCTCCTCC 7: 80,512,904 probably benign Het
Catsperg1 T C 7: 29,206,567 I196V probably benign Het
Cbx2 T A 11: 119,027,926 S106T probably benign Het
Ccar2 T A 14: 70,143,069 E354V probably benign Het
Ccr1 A G 9: 123,964,106 I129T probably damaging Het
Cdkl2 T A 5: 92,033,217 I188F probably damaging Het
Cep350 T C 1: 155,862,154 N2648D probably benign Het
Chtf18 A G 17: 25,721,244 S658P probably benign Het
Csnka2ip G A 16: 64,479,381 Q207* probably null Het
Dennd5a A G 7: 109,894,666 L1253P probably damaging Het
Dennd6a T A 14: 26,629,534 I374K probably damaging Het
Dut T C 2: 125,251,019 probably null Het
Gcm1 T C 9: 78,059,783 Y95H probably benign Het
Grid2 A T 6: 64,345,593 I526F probably damaging Het
Hectd4 T A 5: 121,334,375 Y2725N possibly damaging Het
Helq A T 5: 100,768,384 N907K possibly damaging Het
Hpse G A 5: 100,695,569 Q246* probably null Het
Kcnj15 C T 16: 95,296,259 H247Y probably benign Het
Kif27 C A 13: 58,345,716 V138F probably damaging Het
Map7 T G 10: 20,278,233 D698E unknown Het
Mtmr11 A T 3: 96,171,188 S687C probably benign Het
Ncbp2 CGTCTGGATG CG 16: 31,956,343 probably null Het
Nup210l G A 3: 90,172,068 G953E probably damaging Het
Olfr297 T A 7: 86,527,102 I115N possibly damaging Het
Piezo2 G T 18: 63,086,607 P792T probably damaging Het
Pld3 T C 7: 27,537,731 D241G probably damaging Het
Prss35 G T 9: 86,755,653 V159F probably damaging Het
Rimbp3 A T 16: 17,212,929 M1406L probably benign Het
Serpina3g T C 12: 104,239,082 F27L probably damaging Het
Setd1b G A 5: 123,161,799 probably benign Het
Sh3glb1 T C 3: 144,705,605 K13E probably damaging Het
Slc29a1 A T 17: 45,589,245 I217N possibly damaging Het
Spag17 A T 3: 100,103,132 T1981S probably benign Het
Svil A C 18: 5,057,323 E590D probably benign Het
Synm A G 7: 67,734,966 S541P probably damaging Het
Vmn2r108 A T 17: 20,472,347 Y82* probably null Het
Other mutations in Gm4951
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00717:Gm4951 APN 18 60246293 missense probably damaging 1.00
IGL00807:Gm4951 APN 18 60245411 missense probably damaging 1.00
IGL00956:Gm4951 APN 18 60246190 missense probably damaging 1.00
IGL01017:Gm4951 APN 18 60245436 missense possibly damaging 0.87
IGL01929:Gm4951 APN 18 60246482 missense probably benign 0.02
IGL02267:Gm4951 APN 18 60246398 missense probably damaging 0.97
IGL02276:Gm4951 APN 18 60246079 missense probably damaging 0.99
IGL02499:Gm4951 APN 18 60245638 missense probably damaging 1.00
IGL02538:Gm4951 APN 18 60245872 nonsense probably null
IGL03139:Gm4951 APN 18 60246149 missense probably benign 0.01
IGL03209:Gm4951 APN 18 60246071 missense probably damaging 1.00
IGL03270:Gm4951 APN 18 60245476 missense probably benign 0.01
IGL03325:Gm4951 APN 18 60245811 nonsense probably null
Carboniferous UTSW 18 60245768 missense probably damaging 1.00
Oily UTSW 18 60245652 missense probably damaging 1.00
R0554:Gm4951 UTSW 18 60245417 missense probably benign 0.15
R2046:Gm4951 UTSW 18 60245499 missense probably benign 0.00
R2296:Gm4951 UTSW 18 60245470 missense probably benign 0.00
R4583:Gm4951 UTSW 18 60246080 missense possibly damaging 0.93
R5500:Gm4951 UTSW 18 60246020 missense probably damaging 0.99
R5532:Gm4951 UTSW 18 60246070 missense probably benign 0.23
R5938:Gm4951 UTSW 18 60245652 missense probably damaging 1.00
R7191:Gm4951 UTSW 18 60246257 missense probably benign 0.01
R7238:Gm4951 UTSW 18 60246283 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- GAGGTAAACTCTACAGTCAGAGAC -3'
(R):5'- TCCACCTGTGTTCTCACGAAG -3'

Sequencing Primer
(F):5'- GATAATACCCCGCTCAATGTTG -3'
(R):5'- CCTGTGTTCTCACGAAGTAGAATTC -3'
Posted On2018-05-24