Incidental Mutation 'R6447:Smarcal1'
ID 519216
Institutional Source Beutler Lab
Gene Symbol Smarcal1
Ensembl Gene ENSMUSG00000039354
Gene Name SWI/SNF related matrix associated, actin dependent regulator of chromatin, subfamily a-like 1
Synonyms Mharp, 6030401P21Rik
MMRRC Submission 044389-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6447 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 72622410-72672293 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 72625033 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Leucine at position 60 (S60L)
Ref Sequence ENSEMBL: ENSMUSP00000120230 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047615] [ENSMUST00000133123] [ENSMUST00000145868] [ENSMUST00000152225]
AlphaFold Q8BJL0
Predicted Effect probably benign
Transcript: ENSMUST00000047615
AA Change: S60L

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000047589
Gene: ENSMUSG00000039354
AA Change: S60L

DomainStartEndE-ValueType
low complexity region 31 51 N/A INTRINSIC
Pfam:HARP 214 268 3.6e-26 PFAM
Pfam:HARP 302 356 1.2e-26 PFAM
DEXDc 391 564 7.01e-17 SMART
low complexity region 632 641 N/A INTRINSIC
HELICc 697 780 8.17e-18 SMART
low complexity region 879 889 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000133123
AA Change: S60L
SMART Domains Protein: ENSMUSP00000114848
Gene: ENSMUSG00000039354
AA Change: S60L

DomainStartEndE-ValueType
low complexity region 31 51 N/A INTRINSIC
Pfam:HARP 66 106 1.7e-14 PFAM
Pfam:HARP 140 194 2.2e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136498
Predicted Effect probably damaging
Transcript: ENSMUST00000145868
AA Change: S60L

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000120230
Gene: ENSMUSG00000039354
AA Change: S60L

DomainStartEndE-ValueType
low complexity region 31 51 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150725
Predicted Effect probably benign
Transcript: ENSMUST00000152225
AA Change: S60L

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000137833
Gene: ENSMUSG00000039354
AA Change: S60L

DomainStartEndE-ValueType
low complexity region 31 51 N/A INTRINSIC
Pfam:HARP 214 268 8e-29 PFAM
Pfam:HARP 302 356 3e-26 PFAM
DEXDc 391 564 7.01e-17 SMART
low complexity region 632 641 N/A INTRINSIC
HELICc 697 780 8.17e-18 SMART
low complexity region 879 889 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152814
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156797
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SWI/SNF family of proteins. Members of this family have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein shows sequence similarity to the E. coli RNA polymerase-binding protein HepA. Mutations in this gene are a cause of Schimke immunoosseous dysplasia (SIOD), an autosomal recessive disorder with the diagnostic features of spondyloepiphyseal dysplasia, renal dysfunction, and T-cell immunodeficiency. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele display reduced B cell counts and increased susceptibility to heat induced mortality. Treatment of homozygous null mice with alpha-amanitin results in phenotypes similar to Schimke Type Immunoosseous Dysplasia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl2fm3 A G 3: 59,772,819 (GRCm39) I108V probably damaging Het
Axl C A 7: 25,469,708 (GRCm39) R476I probably damaging Het
Casr A G 16: 36,315,907 (GRCm39) L721P probably damaging Het
Cntn6 A T 6: 104,836,409 (GRCm39) H925L probably damaging Het
Csmd1 T C 8: 15,960,527 (GRCm39) Y3296C probably damaging Het
Dnah3 G A 7: 119,522,277 (GRCm39) T3972M probably benign Het
Ect2 A G 3: 27,169,633 (GRCm39) F740S probably damaging Het
Eif1ad10 T C 12: 88,216,494 (GRCm39) D126G unknown Het
Exoc1 T A 5: 76,691,364 (GRCm39) D222E probably damaging Het
Hdac2 T C 10: 36,869,812 (GRCm39) V258A possibly damaging Het
Lrrk1 A G 7: 65,952,476 (GRCm39) S487P probably benign Het
Lyplal1 A T 1: 185,821,639 (GRCm39) probably null Het
Nwd2 T A 5: 63,964,898 (GRCm39) I1494N probably benign Het
Pcdhb22 A G 18: 37,653,269 (GRCm39) E579G possibly damaging Het
Samd8 T C 14: 21,842,624 (GRCm39) probably null Het
Sccpdh A G 1: 179,506,453 (GRCm39) *131W probably null Het
Stau2 A T 1: 16,460,049 (GRCm39) V264E possibly damaging Het
T T C 17: 8,660,463 (GRCm39) I217T possibly damaging Het
Tbc1d1 C T 5: 64,490,836 (GRCm39) L896F probably damaging Het
Thap1 CAGCATCTGCTCGGAGCA CAGCA 8: 26,650,884 (GRCm39) probably null Het
Tmprss11f T C 5: 86,676,086 (GRCm39) Y365C probably damaging Het
Trdv4 A G 14: 54,312,931 (GRCm39) T102A probably damaging Het
Vmn1r205 G T 13: 22,776,912 (GRCm39) N63K probably damaging Het
Vps13b T C 15: 35,572,272 (GRCm39) V963A probably benign Het
Zswim2 T C 2: 83,745,457 (GRCm39) probably null Het
Other mutations in Smarcal1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01358:Smarcal1 APN 1 72,655,724 (GRCm39) missense possibly damaging 0.80
IGL01658:Smarcal1 APN 1 72,625,290 (GRCm39) missense probably benign 0.00
IGL01980:Smarcal1 APN 1 72,655,679 (GRCm39) nonsense probably null
IGL02007:Smarcal1 APN 1 72,635,099 (GRCm39) missense probably damaging 0.98
IGL02153:Smarcal1 APN 1 72,672,214 (GRCm39) utr 3 prime probably benign
IGL02496:Smarcal1 APN 1 72,659,247 (GRCm39) missense probably damaging 1.00
IGL03084:Smarcal1 APN 1 72,638,094 (GRCm39) splice site probably null
IGL03135:Smarcal1 APN 1 72,655,660 (GRCm39) splice site probably null
IGL03306:Smarcal1 APN 1 72,665,625 (GRCm39) missense probably benign 0.12
R0133:Smarcal1 UTSW 1 72,672,010 (GRCm39) missense probably benign 0.05
R0315:Smarcal1 UTSW 1 72,634,970 (GRCm39) nonsense probably null
R0396:Smarcal1 UTSW 1 72,665,632 (GRCm39) missense probably benign 0.03
R0891:Smarcal1 UTSW 1 72,638,015 (GRCm39) missense probably damaging 0.99
R1799:Smarcal1 UTSW 1 72,625,120 (GRCm39) missense probably damaging 0.97
R1854:Smarcal1 UTSW 1 72,625,258 (GRCm39) missense possibly damaging 0.77
R3725:Smarcal1 UTSW 1 72,665,755 (GRCm39) missense possibly damaging 0.88
R3726:Smarcal1 UTSW 1 72,665,755 (GRCm39) missense possibly damaging 0.88
R4164:Smarcal1 UTSW 1 72,665,848 (GRCm39) intron probably benign
R4438:Smarcal1 UTSW 1 72,650,637 (GRCm39) intron probably benign
R4722:Smarcal1 UTSW 1 72,650,496 (GRCm39) missense probably damaging 1.00
R4796:Smarcal1 UTSW 1 72,636,599 (GRCm39) missense probably benign
R4989:Smarcal1 UTSW 1 72,672,019 (GRCm39) missense possibly damaging 0.84
R5242:Smarcal1 UTSW 1 72,630,242 (GRCm39) missense probably benign 0.00
R5367:Smarcal1 UTSW 1 72,635,135 (GRCm39) critical splice donor site probably null
R5418:Smarcal1 UTSW 1 72,638,068 (GRCm39) missense probably benign 0.01
R5430:Smarcal1 UTSW 1 72,665,776 (GRCm39) missense probably damaging 1.00
R5591:Smarcal1 UTSW 1 72,630,412 (GRCm39) missense probably damaging 1.00
R5607:Smarcal1 UTSW 1 72,625,372 (GRCm39) missense probably benign 0.00
R5809:Smarcal1 UTSW 1 72,630,296 (GRCm39) missense probably benign 0.09
R6395:Smarcal1 UTSW 1 72,655,716 (GRCm39) missense possibly damaging 0.82
R6852:Smarcal1 UTSW 1 72,630,332 (GRCm39) missense possibly damaging 0.75
R7060:Smarcal1 UTSW 1 72,652,101 (GRCm39) missense probably damaging 1.00
R7692:Smarcal1 UTSW 1 72,625,179 (GRCm39) missense probably benign 0.08
R7975:Smarcal1 UTSW 1 72,652,150 (GRCm39) missense probably benign 0.08
R8232:Smarcal1 UTSW 1 72,665,722 (GRCm39) missense probably damaging 1.00
R8407:Smarcal1 UTSW 1 72,640,554 (GRCm39) missense probably benign 0.04
R8901:Smarcal1 UTSW 1 72,624,939 (GRCm39) missense possibly damaging 0.71
R9329:Smarcal1 UTSW 1 72,665,697 (GRCm39) missense probably damaging 0.99
R9548:Smarcal1 UTSW 1 72,671,999 (GRCm39) missense possibly damaging 0.84
Z1177:Smarcal1 UTSW 1 72,630,426 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATCCCTGCATGAGCCTATC -3'
(R):5'- TTAGAGGCTCCTGGAGGACTTG -3'

Sequencing Primer
(F):5'- AAAATGTCCTTGCCACTTACAGAGG -3'
(R):5'- CTCCTGGAGGACTTGGGTTAG -3'
Posted On 2018-05-24