Incidental Mutation 'R6447:Lrrk1'
ID519228
Institutional Source Beutler Lab
Gene Symbol Lrrk1
Ensembl Gene ENSMUSG00000015133
Gene Nameleucine-rich repeat kinase 1
Synonyms
MMRRC Submission 044389-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6447 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location66226912-66388350 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 66302728 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 487 (S487P)
Ref Sequence ENSEMBL: ENSMUSP00000015277 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015277]
Predicted Effect probably benign
Transcript: ENSMUST00000015277
AA Change: S487P

PolyPhen 2 Score 0.195 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000015277
Gene: ENSMUSG00000015133
AA Change: S487P

DomainStartEndE-ValueType
ANK 86 116 9.33e2 SMART
ANK 119 148 1.14e2 SMART
ANK 152 182 8.36e1 SMART
ANK 193 223 2.6e1 SMART
LRR 278 300 2.84e2 SMART
LRR 301 325 7.79e0 SMART
LRR 328 351 3.27e1 SMART
LRR_TYP 379 401 2.53e-2 SMART
LRR 403 427 5.89e1 SMART
LRR 472 493 5.27e1 SMART
LRR 548 569 2.92e2 SMART
LRR 570 594 5.88e0 SMART
Pfam:Arf 625 786 2e-8 PFAM
Pfam:Roc 640 761 3.1e-24 PFAM
Pfam:Ras 640 782 2.2e-7 PFAM
Pfam:COR 844 1046 4.7e-26 PFAM
low complexity region 1109 1119 N/A INTRINSIC
low complexity region 1209 1222 N/A INTRINSIC
Pfam:Pkinase 1243 1521 7.8e-40 PFAM
Pfam:Pkinase_Tyr 1244 1520 9.4e-39 PFAM
low complexity region 1642 1654 N/A INTRINSIC
low complexity region 1839 1846 N/A INTRINSIC
low complexity region 1852 1871 N/A INTRINSIC
low complexity region 1957 1970 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multi-domain protein that is a leucine-rich repeat kinase and a GDP/GTP binding protein. The encoded protein is thought to play a role in the regulation of bone mass. Mice lacking a similar gene showed severe osteopetrosis, increased bone mineralization and decreased bone resorption. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit preweaning lethality. Mice homozygous for another knock-out allele exhibit severe osteopetrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Axl C A 7: 25,770,283 R476I probably damaging Het
Casr A G 16: 36,495,545 L721P probably damaging Het
Cntn6 A T 6: 104,859,448 H925L probably damaging Het
Csmd1 T C 8: 15,910,527 Y3296C probably damaging Het
Dnah3 G A 7: 119,923,054 T3972M probably benign Het
Ect2 A G 3: 27,115,484 F740S probably damaging Het
Exoc1 T A 5: 76,543,517 D222E probably damaging Het
Gm8298 A G 3: 59,865,398 I108V probably damaging Het
Gm8332 T C 12: 88,249,724 D126G unknown Het
Hdac2 T C 10: 36,993,816 V258A possibly damaging Het
Lyplal1 A T 1: 186,089,442 probably null Het
Nwd2 T A 5: 63,807,555 I1494N probably benign Het
Pcdhb22 A G 18: 37,520,216 E579G possibly damaging Het
Samd8 T C 14: 21,792,556 probably null Het
Sccpdh A G 1: 179,678,888 *131W probably null Het
Smarcal1 C T 1: 72,585,874 S60L probably damaging Het
Stau2 A T 1: 16,389,825 V264E possibly damaging Het
T T C 17: 8,441,631 I217T possibly damaging Het
Tbc1d1 C T 5: 64,333,493 L896F probably damaging Het
Thap1 CAGCATCTGCTCGGAGCA CAGCA 8: 26,160,856 probably null Het
Tmprss11f T C 5: 86,528,227 Y365C probably damaging Het
Trdv4 A G 14: 54,075,474 T102A probably damaging Het
Vmn1r205 G T 13: 22,592,742 N63K probably damaging Het
Vps13b T C 15: 35,572,126 V963A probably benign Het
Zswim2 T C 2: 83,915,113 probably null Het
Other mutations in Lrrk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01365:Lrrk1 APN 7 66287701 missense probably damaging 1.00
IGL01511:Lrrk1 APN 7 66265450 missense possibly damaging 0.48
IGL02337:Lrrk1 APN 7 66279416 missense possibly damaging 0.92
IGL02636:Lrrk1 APN 7 66308659 critical splice donor site probably null
IGL02679:Lrrk1 APN 7 66274872 missense probably damaging 1.00
IGL02711:Lrrk1 APN 7 66330767 missense probably damaging 1.00
IGL02742:Lrrk1 APN 7 66308691 missense probably benign 0.12
IGL02878:Lrrk1 APN 7 66262563 missense probably benign
IGL03135:Lrrk1 APN 7 66262890 missense probably benign 0.00
IGL03191:Lrrk1 APN 7 66259959 missense probably damaging 0.99
IGL03198:Lrrk1 APN 7 66306894 missense probably damaging 1.00
combustion UTSW 7 66262665 missense possibly damaging 0.94
Heiland UTSW 7 66262733 missense probably damaging 0.96
liebster UTSW 7 66294981 missense probably damaging 1.00
magi UTSW 7 66281648 missense probably damaging 1.00
oxidation UTSW 7 66279372 missense probably benign 0.00
phlogiston UTSW 7 66278520 splice site probably benign
savior UTSW 7 66262487 missense probably damaging 1.00
wenig UTSW 7 66273001 missense probably damaging 1.00
R0105:Lrrk1 UTSW 7 66292341 missense probably damaging 1.00
R0105:Lrrk1 UTSW 7 66292341 missense probably damaging 1.00
R0276:Lrrk1 UTSW 7 66296263 splice site probably benign
R0505:Lrrk1 UTSW 7 66290908 splice site probably null
R0609:Lrrk1 UTSW 7 66266615 splice site probably null
R0650:Lrrk1 UTSW 7 66292336 missense probably damaging 1.00
R0676:Lrrk1 UTSW 7 66294981 missense probably damaging 1.00
R1157:Lrrk1 UTSW 7 66262283 missense probably benign 0.00
R1435:Lrrk1 UTSW 7 66273028 missense probably damaging 1.00
R1468:Lrrk1 UTSW 7 66259974 missense probably damaging 1.00
R1468:Lrrk1 UTSW 7 66259974 missense probably damaging 1.00
R1498:Lrrk1 UTSW 7 66302671 nonsense probably null
R1620:Lrrk1 UTSW 7 66381538 missense probably benign 0.00
R1884:Lrrk1 UTSW 7 66262437 missense probably benign
R1891:Lrrk1 UTSW 7 66279300 missense probably damaging 1.00
R1989:Lrrk1 UTSW 7 66281684 missense probably damaging 1.00
R2107:Lrrk1 UTSW 7 66279282 missense probably damaging 1.00
R2140:Lrrk1 UTSW 7 66330750 missense probably damaging 1.00
R2144:Lrrk1 UTSW 7 66296163 missense probably damaging 0.98
R2147:Lrrk1 UTSW 7 66285411 splice site probably null
R3176:Lrrk1 UTSW 7 66305521 missense possibly damaging 0.69
R3276:Lrrk1 UTSW 7 66305521 missense possibly damaging 0.69
R3886:Lrrk1 UTSW 7 66292364 missense probably damaging 1.00
R3893:Lrrk1 UTSW 7 66278520 splice site probably benign
R3906:Lrrk1 UTSW 7 66294903 missense possibly damaging 0.84
R4259:Lrrk1 UTSW 7 66330764 missense probably damaging 1.00
R4649:Lrrk1 UTSW 7 66273053 missense probably benign 0.12
R4653:Lrrk1 UTSW 7 66273053 missense probably benign 0.12
R4672:Lrrk1 UTSW 7 66279372 missense probably benign 0.00
R4693:Lrrk1 UTSW 7 66262487 missense probably damaging 1.00
R4729:Lrrk1 UTSW 7 66262293 missense probably benign
R4737:Lrrk1 UTSW 7 66306873 missense probably benign 0.09
R4795:Lrrk1 UTSW 7 66262665 missense possibly damaging 0.94
R4911:Lrrk1 UTSW 7 66295454 missense probably damaging 0.97
R5002:Lrrk1 UTSW 7 66332363 missense probably damaging 1.00
R5254:Lrrk1 UTSW 7 66307107 missense probably benign 0.00
R5407:Lrrk1 UTSW 7 66270797 missense probably benign 0.20
R5482:Lrrk1 UTSW 7 66330670 missense probably benign
R5600:Lrrk1 UTSW 7 66307215 missense probably benign 0.31
R5615:Lrrk1 UTSW 7 66287615 missense probably damaging 1.00
R6041:Lrrk1 UTSW 7 66262133 missense probably benign
R6211:Lrrk1 UTSW 7 66302710 missense possibly damaging 0.89
R6271:Lrrk1 UTSW 7 66307103 critical splice donor site probably null
R6276:Lrrk1 UTSW 7 66306839 splice site probably null
R6478:Lrrk1 UTSW 7 66262733 missense probably damaging 0.96
R6615:Lrrk1 UTSW 7 66281648 missense probably damaging 1.00
R6745:Lrrk1 UTSW 7 66273001 missense probably damaging 1.00
R6836:Lrrk1 UTSW 7 66342779 missense probably benign 0.05
R6995:Lrrk1 UTSW 7 66292342 missense probably damaging 1.00
R7107:Lrrk1 UTSW 7 66287443 missense possibly damaging 0.94
R7137:Lrrk1 UTSW 7 66285279 missense probably benign 0.06
R7203:Lrrk1 UTSW 7 66270825 missense probably damaging 1.00
R7224:Lrrk1 UTSW 7 66332386 missense probably damaging 0.99
R7239:Lrrk1 UTSW 7 66262155 missense probably benign
R7440:Lrrk1 UTSW 7 66290854 missense probably damaging 1.00
R7515:Lrrk1 UTSW 7 66262562 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCTGCAGCCTTCATATTGCTGAG -3'
(R):5'- AGAGGATCTGGGGAGTTTCC -3'

Sequencing Primer
(F):5'- GGAGTATTTCATCCACCCTAAGTG -3'
(R):5'- AGTTTCCTAAGTAGAAGTAGGCTG -3'
Posted On2018-05-24