Incidental Mutation 'R6448:Dlgap1'
ID519270
Institutional Source Beutler Lab
Gene Symbol Dlgap1
Ensembl Gene ENSMUSG00000003279
Gene NameDLG associated protein 1
SynonymsGKAP/SAPAP, 4933422O14Rik, SAPAP1, Gkap, Sapap1, D17Bwg0511e, DAP-1 beta
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6448 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location69969073-70821413 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 70593330 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 380 (E380G)
Ref Sequence ENSEMBL: ENSMUSP00000122896 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060072] [ENSMUST00000097288] [ENSMUST00000133717] [ENSMUST00000133983] [ENSMUST00000135938] [ENSMUST00000140728] [ENSMUST00000146730] [ENSMUST00000148486] [ENSMUST00000155016]
Predicted Effect possibly damaging
Transcript: ENSMUST00000060072
AA Change: E380G

PolyPhen 2 Score 0.587 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000052858
Gene: ENSMUSG00000003279
AA Change: E380G

DomainStartEndE-ValueType
low complexity region 180 210 N/A INTRINSIC
low complexity region 515 539 N/A INTRINSIC
low complexity region 542 559 N/A INTRINSIC
low complexity region 628 642 N/A INTRINSIC
Pfam:GKAP 643 982 6.8e-139 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000097288
AA Change: E72G

PolyPhen 2 Score 0.176 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000094890
Gene: ENSMUSG00000003279
AA Change: E72G

DomainStartEndE-ValueType
low complexity region 208 228 N/A INTRINSIC
low complexity region 244 261 N/A INTRINSIC
low complexity region 330 344 N/A INTRINSIC
Pfam:GKAP 345 625 9.4e-106 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126801
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130971
Predicted Effect probably benign
Transcript: ENSMUST00000133717
AA Change: E82G

PolyPhen 2 Score 0.394 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000122370
Gene: ENSMUSG00000003279
AA Change: E82G

DomainStartEndE-ValueType
low complexity region 218 238 N/A INTRINSIC
low complexity region 312 326 N/A INTRINSIC
Pfam:GKAP 327 666 1.3e-139 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000133983
AA Change: E380G

PolyPhen 2 Score 0.587 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000116716
Gene: ENSMUSG00000003279
AA Change: E380G

DomainStartEndE-ValueType
low complexity region 180 210 N/A INTRINSIC
low complexity region 515 539 N/A INTRINSIC
low complexity region 542 559 N/A INTRINSIC
low complexity region 628 642 N/A INTRINSIC
Pfam:GKAP 643 982 6.8e-139 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000135938
AA Change: E380G

PolyPhen 2 Score 0.587 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000118497
Gene: ENSMUSG00000003279
AA Change: E380G

DomainStartEndE-ValueType
low complexity region 180 210 N/A INTRINSIC
low complexity region 516 536 N/A INTRINSIC
low complexity region 610 624 N/A INTRINSIC
Pfam:GKAP 625 964 9.3e-139 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140728
AA Change: E80G

PolyPhen 2 Score 0.444 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000117358
Gene: ENSMUSG00000003279
AA Change: E80G

DomainStartEndE-ValueType
low complexity region 216 236 N/A INTRINSIC
low complexity region 252 269 N/A INTRINSIC
low complexity region 338 352 N/A INTRINSIC
Pfam:GKAP 353 692 1.4e-139 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000146730
AA Change: E380G

PolyPhen 2 Score 0.587 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000116072
Gene: ENSMUSG00000003279
AA Change: E380G

DomainStartEndE-ValueType
low complexity region 180 210 N/A INTRINSIC
low complexity region 516 536 N/A INTRINSIC
low complexity region 552 569 N/A INTRINSIC
low complexity region 638 652 N/A INTRINSIC
Pfam:GKAP 653 933 9.5e-106 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000148486
AA Change: E80G

PolyPhen 2 Score 0.587 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000122337
Gene: ENSMUSG00000003279
AA Change: E80G

DomainStartEndE-ValueType
low complexity region 215 239 N/A INTRINSIC
low complexity region 242 259 N/A INTRINSIC
low complexity region 328 342 N/A INTRINSIC
Pfam:GKAP 343 682 1.3e-139 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150260
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150798
Predicted Effect possibly damaging
Transcript: ENSMUST00000155016
AA Change: E380G

PolyPhen 2 Score 0.587 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000122896
Gene: ENSMUSG00000003279
AA Change: E380G

DomainStartEndE-ValueType
low complexity region 180 210 N/A INTRINSIC
low complexity region 516 536 N/A INTRINSIC
low complexity region 552 569 N/A INTRINSIC
low complexity region 638 652 N/A INTRINSIC
Pfam:GKAP 660 992 2e-153 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156946
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 97% (32/33)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap5 A T 12: 52,517,663 K472N probably benign Het
C2 T G 17: 34,863,359 D298A possibly damaging Het
Col16a1 T G 4: 130,058,988 L409R probably damaging Het
Fam111a C A 19: 12,588,337 H483Q probably benign Het
Fancc C T 13: 63,340,428 R246Q probably damaging Het
Glb1 A T 9: 114,434,431 Q256L probably damaging Het
Gm9195 A T 14: 72,434,011 D2611E possibly damaging Het
Gsto1 C T 19: 47,857,981 T89I probably benign Het
Hmcn2 A G 2: 31,420,820 S3359G probably benign Het
Hook3 T A 8: 26,093,664 N87I probably benign Het
Htt T A 5: 34,875,992 M1868K probably benign Het
Ighv1-19 T C 12: 114,708,676 E107G probably damaging Het
Il20rb A T 9: 100,474,933 M48K probably benign Het
Inpp5j T C 11: 3,495,387 H822R probably damaging Het
Kif14 G T 1: 136,503,347 V1161F probably damaging Het
Klhdc2 T A 12: 69,303,920 D169E probably benign Het
Ly75 A G 2: 60,299,045 probably null Het
Myh15 T G 16: 49,171,932 S1590A probably damaging Het
Ncbp2 CGTCTGGATG CG 16: 31,956,343 probably null Het
Neb T C 2: 52,148,814 D6748G probably damaging Het
Nfrkb T C 9: 31,394,789 Y142H probably damaging Het
Olfr1051 T A 2: 86,276,347 I47F probably benign Het
Olfr1355 G A 10: 78,879,682 C170Y possibly damaging Het
Olfr784 A T 10: 129,388,152 D173V probably damaging Het
Prm2 G A 16: 10,791,961 probably benign Het
Ralgapa1 T C 12: 55,719,661 T1283A probably benign Het
Rest T C 5: 77,281,471 L579P possibly damaging Het
Slc6a1 C T 6: 114,302,086 T46I possibly damaging Het
Tcf20 A G 15: 82,852,660 I1530T probably benign Het
Tox T G 4: 6,822,975 D114A probably benign Het
Ulk4 C T 9: 121,103,630 G1048D probably damaging Het
Other mutations in Dlgap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Dlgap1 APN 17 70516085 missense probably benign 0.02
IGL01413:Dlgap1 APN 17 70516074 missense probably benign 0.00
IGL01531:Dlgap1 APN 17 70516379 missense probably damaging 1.00
IGL02226:Dlgap1 APN 17 70516034 missense probably damaging 1.00
R0453:Dlgap1 UTSW 17 70761346 missense probably benign 0.03
R0482:Dlgap1 UTSW 17 70516190 missense probably benign 0.11
R0520:Dlgap1 UTSW 17 70516994 nonsense probably null
R1951:Dlgap1 UTSW 17 70761311 missense probably damaging 0.96
R2072:Dlgap1 UTSW 17 70662770 missense probably damaging 0.99
R2076:Dlgap1 UTSW 17 70786831 nonsense probably null
R3438:Dlgap1 UTSW 17 70516361 missense probably damaging 0.97
R3743:Dlgap1 UTSW 17 70718226 critical splice donor site probably null
R3881:Dlgap1 UTSW 17 70786815 missense probably damaging 1.00
R3981:Dlgap1 UTSW 17 70516785 missense probably damaging 1.00
R4043:Dlgap1 UTSW 17 70761080 missense probably damaging 1.00
R4272:Dlgap1 UTSW 17 70766043 missense probably benign
R4273:Dlgap1 UTSW 17 70766043 missense probably benign
R4557:Dlgap1 UTSW 17 70516689 missense probably benign 0.01
R4652:Dlgap1 UTSW 17 70761095 missense probably damaging 1.00
R4771:Dlgap1 UTSW 17 70593380 nonsense probably null
R5000:Dlgap1 UTSW 17 70766058 missense probably damaging 1.00
R5004:Dlgap1 UTSW 17 70718227 critical splice donor site probably null
R5291:Dlgap1 UTSW 17 70718210 missense probably benign 0.03
R5304:Dlgap1 UTSW 17 70815207 missense probably damaging 1.00
R5473:Dlgap1 UTSW 17 70517030 intron probably benign
R5522:Dlgap1 UTSW 17 70516998 critical splice donor site probably null
R5586:Dlgap1 UTSW 17 70818161 missense probably damaging 1.00
R5742:Dlgap1 UTSW 17 70718199 missense probably benign
R5802:Dlgap1 UTSW 17 70766091 critical splice donor site probably null
R5850:Dlgap1 UTSW 17 70787092 missense probably damaging 1.00
R5857:Dlgap1 UTSW 17 70815393 intron probably benign
R5883:Dlgap1 UTSW 17 70517013 intron probably benign
R6045:Dlgap1 UTSW 17 70818098 missense probably damaging 1.00
R6336:Dlgap1 UTSW 17 70815289 missense probably damaging 1.00
R6682:Dlgap1 UTSW 17 70787123 missense probably damaging 1.00
R6795:Dlgap1 UTSW 17 70818074 missense possibly damaging 0.48
R7147:Dlgap1 UTSW 17 70662758 missense probably benign 0.00
R7187:Dlgap1 UTSW 17 70516098 missense possibly damaging 0.93
T0975:Dlgap1 UTSW 17 70516955 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- CCTAGGTTCCCCAGGATGAATG -3'
(R):5'- AGAGTGCACCAGCTTTCCTC -3'

Sequencing Primer
(F):5'- TGAATGGTCAGGGTACACACCTC -3'
(R):5'- TGATGACACTGGCATCTACAAGTC -3'
Posted On2018-05-24