Incidental Mutation 'R6450:Olfr1317'
ID519329
Institutional Source Beutler Lab
Gene Symbol Olfr1317
Ensembl Gene ENSMUSG00000050776
Gene Nameolfactory receptor 1317
SynonymsGA_x6K02T2Q125-73188162-73189112, MOR245-4
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.159) question?
Stock #R6450 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location112140329-112144054 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 112142380 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 145 (L145*)
Ref Sequence ENSEMBL: ENSMUSP00000149091 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060098] [ENSMUST00000214801] [ENSMUST00000216988]
Predicted Effect probably null
Transcript: ENSMUST00000060098
AA Change: L145*
SMART Domains Protein: ENSMUSP00000058587
Gene: ENSMUSG00000050776
AA Change: L145*

DomainStartEndE-ValueType
Pfam:7tm_4 31 305 5.1e-40 PFAM
Pfam:7tm_1 41 287 5.2e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213693
Predicted Effect probably null
Transcript: ENSMUST00000214801
AA Change: L145*
Predicted Effect probably null
Transcript: ENSMUST00000216988
AA Change: L145*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 98.5%
  • 20x: 95.1%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 C G 7: 120,216,226 N232K probably benign Het
Acaca T A 11: 84,280,468 V5E probably damaging Het
Adam18 A T 8: 24,629,675 D529E probably benign Het
Adgrb3 T C 1: 25,420,602 T798A probably benign Het
Alyref T C 11: 120,596,046 T130A probably benign Het
Arhgap24 A G 5: 102,897,124 S591G probably benign Het
Carmil1 C T 13: 24,036,564 G655E probably damaging Het
Cdc42bpg T A 19: 6,314,488 probably null Het
Clec12a T A 6: 129,353,403 L48H probably damaging Het
Coq2 C A 5: 100,661,904 probably benign Het
Crb2 C A 2: 37,793,826 F1113L possibly damaging Het
Ctla4 A T 1: 60,912,713 M134L probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Efhb A G 17: 53,452,604 V290A possibly damaging Het
Epha8 T C 4: 136,931,899 N843S probably damaging Het
Eva1a A T 6: 82,092,105 I138F probably damaging Het
Fat2 T A 11: 55,289,310 I1402F probably damaging Het
Fat3 A T 9: 15,999,170 H1845Q possibly damaging Het
Gimap8 T A 6: 48,656,451 F401L probably benign Het
Gm12394 C A 4: 42,792,489 G548W probably damaging Het
Gpr162 C T 6: 124,861,189 R166Q possibly damaging Het
Hdac4 G A 1: 91,984,711 P348S possibly damaging Het
Hist1h2ae A G 13: 23,570,945 V55A probably damaging Het
Hmcn2 T C 2: 31,361,800 V849A probably benign Het
Inpp5b T A 4: 124,792,252 N696K probably damaging Het
Kdm5d G T Y: 927,056 R598L probably damaging Homo
Kidins220 T C 12: 25,057,191 S1548P probably benign Het
Kif2b C A 11: 91,576,366 V364L probably damaging Het
Kitl A G 10: 100,087,394 M1V probably null Het
Klra9 G T 6: 130,179,032 Y253* probably null Het
Map6 T C 7: 99,268,038 I6T probably damaging Het
Mastl T C 2: 23,120,929 T768A probably damaging Het
Mettl16 T C 11: 74,805,338 V335A probably benign Het
Mpl T C 4: 118,448,700 probably null Het
Myo5c C T 9: 75,286,578 T1205I probably benign Het
Nav2 C A 7: 49,594,366 L2114I probably damaging Het
Neb T A 2: 52,194,469 K5330* probably null Het
Nfe2l1 C T 11: 96,827,335 E125K possibly damaging Het
Onecut3 A G 10: 80,496,088 K361E probably damaging Het
Osbpl6 A G 2: 76,564,830 N370S possibly damaging Het
Otud4 T A 8: 79,672,997 M780K probably benign Het
P2rx4 A G 5: 122,727,241 T310A possibly damaging Het
Pcdha11 G T 18: 37,013,162 D769Y probably damaging Het
Pcgf6 C T 19: 47,049,088 R124H probably benign Het
Pibf1 T A 14: 99,137,210 Y362N probably damaging Het
Ppm1g T C 5: 31,203,124 E422G probably benign Het
Prmt8 T C 6: 127,732,643 I85V possibly damaging Het
Prss27 A T 17: 24,045,014 K225* probably null Het
Rai1 A T 11: 60,186,603 T498S probably benign Het
Sbf2 C A 7: 110,462,863 G23V probably damaging Het
Sdha C T 13: 74,334,293 probably null Het
Sgo2a C T 1: 58,002,933 Q140* probably null Het
Sh3rf3 A G 10: 58,984,144 D259G probably damaging Het
Slc27a3 C A 3: 90,385,470 D631Y probably damaging Het
Slc7a10 T C 7: 35,186,590 S37P possibly damaging Het
Slco6d1 A G 1: 98,421,467 T88A probably benign Het
Smad4 A T 18: 73,677,746 S56T possibly damaging Het
Smarcd1 A G 15: 99,707,885 I346V possibly damaging Het
Spast C T 17: 74,368,840 P260S probably benign Het
Sprr2i A T 3: 92,408,710 probably benign Het
Sptbn5 A G 2: 120,047,135 probably benign Het
Taar9 A T 10: 24,109,240 Y99N probably damaging Het
Trappc10 A T 10: 78,209,450 M468K possibly damaging Het
Trim66 T C 7: 109,460,738 R814G probably benign Het
Tspan31 A G 10: 127,068,358 C157R probably damaging Het
Vmn2r90 A G 17: 17,733,236 D554G possibly damaging Het
Vmn2r91 A T 17: 18,085,265 D70V probably damaging Het
Wdfy4 C T 14: 33,108,692 G928R probably damaging Het
Wdr60 A T 12: 116,246,727 Y314* probably null Het
Zfp346 G T 13: 55,113,704 K102N probably damaging Het
Zmym4 G A 4: 126,895,306 P1002S probably damaging Het
Other mutations in Olfr1317
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03294:Olfr1317 APN 2 112142173 missense probably benign 0.12
R1390:Olfr1317 UTSW 2 112142607 missense probably benign 0.35
R1404:Olfr1317 UTSW 2 112142623 missense probably benign 0.01
R1404:Olfr1317 UTSW 2 112142623 missense probably benign 0.01
R1771:Olfr1317 UTSW 2 112142720 nonsense probably null
R3500:Olfr1317 UTSW 2 112142127 missense possibly damaging 0.64
R3894:Olfr1317 UTSW 2 112142014 missense probably benign 0.04
R4289:Olfr1317 UTSW 2 112141974 missense probably benign 0.28
R5646:Olfr1317 UTSW 2 112142683 missense possibly damaging 0.95
R6336:Olfr1317 UTSW 2 112142406 missense probably benign 0.10
R6439:Olfr1317 UTSW 2 112142164 missense probably benign 0.03
R6737:Olfr1317 UTSW 2 112142203 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTGATACAGGTGTGTCCAGCATC -3'
(R):5'- TGTTGGCAGTGACCAGGAAC -3'

Sequencing Primer
(F):5'- TTATGACCTCTTCAGGAAGCAC -3'
(R):5'- TGACCAGGAACTCCAGTCTGTATG -3'
Posted On2018-05-24