Incidental Mutation 'R6450:Inpp5b'
ID519335
Institutional Source Beutler Lab
Gene Symbol Inpp5b
Ensembl Gene ENSMUSG00000028894
Gene Nameinositol polyphosphate-5-phosphatase B
Synonyms75kDa
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_008385.3; MGI:103257

Is this an essential gene? Possibly non essential (E-score: 0.309) question?
Stock #R6450 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location124741850-124801511 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 124792252 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 696 (N696K)
Ref Sequence ENSEMBL: ENSMUSP00000139221 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094782] [ENSMUST00000184454]
Predicted Effect probably damaging
Transcript: ENSMUST00000094782
AA Change: N696K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000092375
Gene: ENSMUSG00000028894
AA Change: N696K

DomainStartEndE-ValueType
Pfam:INPP5B_PH 1 150 4.3e-61 PFAM
low complexity region 206 220 N/A INTRINSIC
IPPc 343 644 6.29e-126 SMART
Blast:RhoGAP 706 732 1e-7 BLAST
Blast:RhoGAP 755 809 2e-24 BLAST
RhoGAP 827 993 6.77e-37 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135971
Predicted Effect probably damaging
Transcript: ENSMUST00000184454
AA Change: N696K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139221
Gene: ENSMUSG00000028894
AA Change: N696K

DomainStartEndE-ValueType
PDB:2KIG|A 1 156 1e-105 PDB
low complexity region 206 220 N/A INTRINSIC
IPPc 343 644 6.29e-126 SMART
PDB:3QBT|H 645 782 6e-49 PDB
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 98.5%
  • 20x: 95.1%
Validation Efficiency 97% (68/70)
MGI Phenotype Strain: 2159609;2159620
FUNCTION: This gene encodes a member of the inositol polyphosphate-5-phosphatase (INPP5) family. This protein hydrolyzes the 5' phosphate from phosphatidylinositol 4,5-bisphosphate and phosphatidylinositol-1,4,5-trisphosphate, which results in changes to multiple signaling pathways. This protein may be involved in protein trafficking and secretion. Homozygous knockout mice exhibit impaired spermatogenesis and male sterility. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygous null male mice are infertile with a disruption in spermatogenesis and a defect in adherens junctions processing. [provided by MGI curators]
Allele List at MGI

All alleles(24) : Targeted(6) Gene trapped(18)

Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 C G 7: 120,216,226 N232K probably benign Het
Acaca T A 11: 84,280,468 V5E probably damaging Het
Adam18 A T 8: 24,629,675 D529E probably benign Het
Adgrb3 T C 1: 25,420,602 T798A probably benign Het
Alyref T C 11: 120,596,046 T130A probably benign Het
Arhgap24 A G 5: 102,897,124 S591G probably benign Het
Carmil1 C T 13: 24,036,564 G655E probably damaging Het
Cdc42bpg T A 19: 6,314,488 probably null Het
Clec12a T A 6: 129,353,403 L48H probably damaging Het
Coq2 C A 5: 100,661,904 probably benign Het
Crb2 C A 2: 37,793,826 F1113L possibly damaging Het
Ctla4 A T 1: 60,912,713 M134L probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Efhb A G 17: 53,452,604 V290A possibly damaging Het
Epha8 T C 4: 136,931,899 N843S probably damaging Het
Eva1a A T 6: 82,092,105 I138F probably damaging Het
Fat2 T A 11: 55,289,310 I1402F probably damaging Het
Fat3 A T 9: 15,999,170 H1845Q possibly damaging Het
Gimap8 T A 6: 48,656,451 F401L probably benign Het
Gm12394 C A 4: 42,792,489 G548W probably damaging Het
Gpr162 C T 6: 124,861,189 R166Q possibly damaging Het
Hdac4 G A 1: 91,984,711 P348S possibly damaging Het
Hist1h2ae A G 13: 23,570,945 V55A probably damaging Het
Hmcn2 T C 2: 31,361,800 V849A probably benign Het
Kdm5d G T Y: 927,056 R598L probably damaging Homo
Kidins220 T C 12: 25,057,191 S1548P probably benign Het
Kif2b C A 11: 91,576,366 V364L probably damaging Het
Kitl A G 10: 100,087,394 M1V probably null Het
Klra9 G T 6: 130,179,032 Y253* probably null Het
Map6 T C 7: 99,268,038 I6T probably damaging Het
Mastl T C 2: 23,120,929 T768A probably damaging Het
Mettl16 T C 11: 74,805,338 V335A probably benign Het
Mpl T C 4: 118,448,700 probably null Het
Myo5c C T 9: 75,286,578 T1205I probably benign Het
Nav2 C A 7: 49,594,366 L2114I probably damaging Het
Neb T A 2: 52,194,469 K5330* probably null Het
Nfe2l1 C T 11: 96,827,335 E125K possibly damaging Het
Olfr1317 T A 2: 112,142,380 L145* probably null Het
Onecut3 A G 10: 80,496,088 K361E probably damaging Het
Osbpl6 A G 2: 76,564,830 N370S possibly damaging Het
Otud4 T A 8: 79,672,997 M780K probably benign Het
P2rx4 A G 5: 122,727,241 T310A possibly damaging Het
Pcdha11 G T 18: 37,013,162 D769Y probably damaging Het
Pcgf6 C T 19: 47,049,088 R124H probably benign Het
Pibf1 T A 14: 99,137,210 Y362N probably damaging Het
Ppm1g T C 5: 31,203,124 E422G probably benign Het
Prmt8 T C 6: 127,732,643 I85V possibly damaging Het
Prss27 A T 17: 24,045,014 K225* probably null Het
Rai1 A T 11: 60,186,603 T498S probably benign Het
Sbf2 C A 7: 110,462,863 G23V probably damaging Het
Sdha C T 13: 74,334,293 probably null Het
Sgo2a C T 1: 58,002,933 Q140* probably null Het
Sh3rf3 A G 10: 58,984,144 D259G probably damaging Het
Slc27a3 C A 3: 90,385,470 D631Y probably damaging Het
Slc7a10 T C 7: 35,186,590 S37P possibly damaging Het
Slco6d1 A G 1: 98,421,467 T88A probably benign Het
Smad4 A T 18: 73,677,746 S56T possibly damaging Het
Smarcd1 A G 15: 99,707,885 I346V possibly damaging Het
Spast C T 17: 74,368,840 P260S probably benign Het
Sprr2i A T 3: 92,408,710 probably benign Het
Sptbn5 A G 2: 120,047,135 probably benign Het
Taar9 A T 10: 24,109,240 Y99N probably damaging Het
Trappc10 A T 10: 78,209,450 M468K possibly damaging Het
Trim66 T C 7: 109,460,738 R814G probably benign Het
Tspan31 A G 10: 127,068,358 C157R probably damaging Het
Vmn2r90 A G 17: 17,733,236 D554G possibly damaging Het
Vmn2r91 A T 17: 18,085,265 D70V probably damaging Het
Wdfy4 C T 14: 33,108,692 G928R probably damaging Het
Wdr60 A T 12: 116,246,727 Y314* probably null Het
Zfp346 G T 13: 55,113,704 K102N probably damaging Het
Zmym4 G A 4: 126,895,306 P1002S probably damaging Het
Other mutations in Inpp5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Inpp5b APN 4 124784375 missense possibly damaging 0.94
IGL00696:Inpp5b APN 4 124742535 start codon destroyed probably null 1.00
IGL00969:Inpp5b APN 4 124783994 missense probably damaging 1.00
IGL01401:Inpp5b APN 4 124746087 missense probably damaging 0.97
IGL01481:Inpp5b APN 4 124800699 unclassified probably null
IGL01517:Inpp5b APN 4 124782436 missense probably benign 0.00
IGL03085:Inpp5b APN 4 124792322 missense probably benign 0.01
IGL03178:Inpp5b APN 4 124785254 missense probably benign 0.02
P0042:Inpp5b UTSW 4 124797910 critical splice donor site probably null
R0504:Inpp5b UTSW 4 124782408 nonsense probably null
R0531:Inpp5b UTSW 4 124795456 missense probably damaging 0.99
R1396:Inpp5b UTSW 4 124789080 missense probably damaging 1.00
R1626:Inpp5b UTSW 4 124783903 missense probably damaging 1.00
R1768:Inpp5b UTSW 4 124793276 nonsense probably null
R2037:Inpp5b UTSW 4 124798299 missense probably damaging 0.98
R2119:Inpp5b UTSW 4 124797869 missense probably benign 0.00
R2132:Inpp5b UTSW 4 124785168 splice site probably benign
R2190:Inpp5b UTSW 4 124785195 missense probably damaging 1.00
R3237:Inpp5b UTSW 4 124780486 missense probably benign 0.04
R3800:Inpp5b UTSW 4 124785345 missense probably damaging 1.00
R4735:Inpp5b UTSW 4 124783967 missense probably damaging 0.99
R4827:Inpp5b UTSW 4 124743850 intron probably benign
R4865:Inpp5b UTSW 4 124751495 missense probably benign
R4868:Inpp5b UTSW 4 124751410 missense probably damaging 0.99
R4913:Inpp5b UTSW 4 124780421 missense probably benign 0.09
R5055:Inpp5b UTSW 4 124743031 critical splice donor site probably null
R5068:Inpp5b UTSW 4 124742649 intron probably null
R5208:Inpp5b UTSW 4 124751317 missense possibly damaging 0.62
R5642:Inpp5b UTSW 4 124782436 missense probably benign 0.00
R5875:Inpp5b UTSW 4 124780406 missense possibly damaging 0.66
R6015:Inpp5b UTSW 4 124798350 missense possibly damaging 0.94
R6288:Inpp5b UTSW 4 124785227 missense probably benign 0.00
R7138:Inpp5b UTSW 4 124785272 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCATAGGCTACTGGTCTTCAG -3'
(R):5'- CTTTAGGCCGAGAATAAAGCATTC -3'

Sequencing Primer
(F):5'- TCTTCAGTGGCCACGTGC -3'
(R):5'- CCGAGAATAAAGCATTCAGAAGC -3'
Posted On2018-05-24