Incidental Mutation 'R6450:Ppm1g'
ID519338
Institutional Source Beutler Lab
Gene Symbol Ppm1g
Ensembl Gene ENSMUSG00000029147
Gene Nameprotein phosphatase 1G (formerly 2C), magnesium-dependent, gamma isoform
SynonymsFin13
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6450 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location31202664-31220687 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 31203124 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 422 (E422G)
Ref Sequence ENSEMBL: ENSMUSP00000144644 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031029] [ENSMUST00000031032] [ENSMUST00000031562] [ENSMUST00000114590] [ENSMUST00000200730] [ENSMUST00000201231] [ENSMUST00000201407] [ENSMUST00000201968] [ENSMUST00000202124] [ENSMUST00000202294] [ENSMUST00000202929]
Predicted Effect probably benign
Transcript: ENSMUST00000031029
SMART Domains Protein: ENSMUSP00000031029
Gene: ENSMUSG00000029146

DomainStartEndE-ValueType
PX 1 105 3.42e-24 SMART
B41 113 274 4.05e-2 SMART
low complexity region 324 342 N/A INTRINSIC
low complexity region 428 441 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000031032
AA Change: E529G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000031032
Gene: ENSMUSG00000029147
AA Change: E529G

DomainStartEndE-ValueType
PP2Cc 15 500 9.7e-103 SMART
PP2C_SIG 219 502 1.05e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000031562
SMART Domains Protein: ENSMUSP00000031562
Gene: ENSMUSG00000043059

DomainStartEndE-ValueType
low complexity region 35 55 N/A INTRINSIC
low complexity region 100 117 N/A INTRINSIC
low complexity region 121 144 N/A INTRINSIC
ZnF_C2H2 148 170 1.33e-1 SMART
ZnF_C2H2 176 198 2.86e-1 SMART
ZnF_C2H2 204 226 1.06e-4 SMART
low complexity region 227 238 N/A INTRINSIC
low complexity region 340 354 N/A INTRINSIC
ZnF_C2H2 358 380 1.03e-2 SMART
ZnF_C2H2 386 408 5.42e-2 SMART
ZnF_C2H2 414 436 2.91e-2 SMART
ZnF_C2H2 442 464 1.38e-3 SMART
ZnF_C2H2 470 492 5.06e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114590
SMART Domains Protein: ENSMUSP00000110238
Gene: ENSMUSG00000043059

DomainStartEndE-ValueType
low complexity region 37 57 N/A INTRINSIC
low complexity region 102 119 N/A INTRINSIC
low complexity region 123 146 N/A INTRINSIC
ZnF_C2H2 150 172 1.33e-1 SMART
ZnF_C2H2 178 200 2.86e-1 SMART
ZnF_C2H2 206 228 1.06e-4 SMART
low complexity region 229 240 N/A INTRINSIC
low complexity region 342 356 N/A INTRINSIC
ZnF_C2H2 360 382 1.03e-2 SMART
ZnF_C2H2 388 410 5.42e-2 SMART
ZnF_C2H2 416 438 2.91e-2 SMART
ZnF_C2H2 444 466 1.38e-3 SMART
ZnF_C2H2 472 494 5.06e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200730
SMART Domains Protein: ENSMUSP00000144504
Gene: ENSMUSG00000029146

DomainStartEndE-ValueType
PX 1 87 2.3e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200778
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200992
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201078
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201119
Predicted Effect probably benign
Transcript: ENSMUST00000201231
SMART Domains Protein: ENSMUSP00000144172
Gene: ENSMUSG00000043059

DomainStartEndE-ValueType
low complexity region 35 55 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201343
Predicted Effect probably benign
Transcript: ENSMUST00000201407
SMART Domains Protein: ENSMUSP00000144556
Gene: ENSMUSG00000029147

DomainStartEndE-ValueType
Blast:PP2Cc 1 155 4e-87 BLAST
low complexity region 156 173 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201968
SMART Domains Protein: ENSMUSP00000144517
Gene: ENSMUSG00000043059

DomainStartEndE-ValueType
low complexity region 80 92 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202032
Predicted Effect probably benign
Transcript: ENSMUST00000202124
SMART Domains Protein: ENSMUSP00000144168
Gene: ENSMUSG00000029146

DomainStartEndE-ValueType
Blast:PX 1 31 6e-8 BLAST
PDB:3LUI|C 1 31 4e-9 PDB
low complexity region 41 54 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202294
AA Change: E422G

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000144644
Gene: ENSMUSG00000029147
AA Change: E422G

DomainStartEndE-ValueType
PP2Cc 15 393 6.6e-105 SMART
PP2C_SIG 38 395 3.7e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202323
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202402
Predicted Effect probably benign
Transcript: ENSMUST00000202929
SMART Domains Protein: ENSMUSP00000143817
Gene: ENSMUSG00000043059

DomainStartEndE-ValueType
low complexity region 50 67 N/A INTRINSIC
Meta Mutation Damage Score 0.07 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 98.5%
  • 20x: 95.1%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the PP2C family of Ser/Thr protein phosphatases. PP2C family members are known to be negative regulators of cell stress response pathways. This phosphatase is found to be responsible for the dephosphorylation of Pre-mRNA splicing factors, which is important for the formation of functional spliceosome. Studies of a similar gene in mice suggested a role of this phosphatase in regulating cell cycle progression. [provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a targeted mutation display perinatal lethality. Mice heterozygous for a targeted mutation display a decrease in prepulse inhibition. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 C G 7: 120,216,226 N232K probably benign Het
Acaca T A 11: 84,280,468 V5E probably damaging Het
Adam18 A T 8: 24,629,675 D529E probably benign Het
Adgrb3 T C 1: 25,420,602 T798A probably benign Het
Alyref T C 11: 120,596,046 T130A probably benign Het
Arhgap24 A G 5: 102,897,124 S591G probably benign Het
Carmil1 C T 13: 24,036,564 G655E probably damaging Het
Cdc42bpg T A 19: 6,314,488 probably null Het
Clec12a T A 6: 129,353,403 L48H probably damaging Het
Coq2 C A 5: 100,661,904 probably benign Het
Crb2 C A 2: 37,793,826 F1113L possibly damaging Het
Ctla4 A T 1: 60,912,713 M134L probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Efhb A G 17: 53,452,604 V290A possibly damaging Het
Epha8 T C 4: 136,931,899 N843S probably damaging Het
Eva1a A T 6: 82,092,105 I138F probably damaging Het
Fat2 T A 11: 55,289,310 I1402F probably damaging Het
Fat3 A T 9: 15,999,170 H1845Q possibly damaging Het
Gimap8 T A 6: 48,656,451 F401L probably benign Het
Gm12394 C A 4: 42,792,489 G548W probably damaging Het
Gpr162 C T 6: 124,861,189 R166Q possibly damaging Het
Hdac4 G A 1: 91,984,711 P348S possibly damaging Het
Hist1h2ae A G 13: 23,570,945 V55A probably damaging Het
Hmcn2 T C 2: 31,361,800 V849A probably benign Het
Inpp5b T A 4: 124,792,252 N696K probably damaging Het
Kdm5d G T Y: 927,056 R598L probably damaging Homo
Kidins220 T C 12: 25,057,191 S1548P probably benign Het
Kif2b C A 11: 91,576,366 V364L probably damaging Het
Kitl A G 10: 100,087,394 M1V probably null Het
Klra9 G T 6: 130,179,032 Y253* probably null Het
Map6 T C 7: 99,268,038 I6T probably damaging Het
Mastl T C 2: 23,120,929 T768A probably damaging Het
Mettl16 T C 11: 74,805,338 V335A probably benign Het
Mpl T C 4: 118,448,700 probably null Het
Myo5c C T 9: 75,286,578 T1205I probably benign Het
Nav2 C A 7: 49,594,366 L2114I probably damaging Het
Neb T A 2: 52,194,469 K5330* probably null Het
Nfe2l1 C T 11: 96,827,335 E125K possibly damaging Het
Olfr1317 T A 2: 112,142,380 L145* probably null Het
Onecut3 A G 10: 80,496,088 K361E probably damaging Het
Osbpl6 A G 2: 76,564,830 N370S possibly damaging Het
Otud4 T A 8: 79,672,997 M780K probably benign Het
P2rx4 A G 5: 122,727,241 T310A possibly damaging Het
Pcdha11 G T 18: 37,013,162 D769Y probably damaging Het
Pcgf6 C T 19: 47,049,088 R124H probably benign Het
Pibf1 T A 14: 99,137,210 Y362N probably damaging Het
Prmt8 T C 6: 127,732,643 I85V possibly damaging Het
Prss27 A T 17: 24,045,014 K225* probably null Het
Rai1 A T 11: 60,186,603 T498S probably benign Het
Sbf2 C A 7: 110,462,863 G23V probably damaging Het
Sdha C T 13: 74,334,293 probably null Het
Sgo2a C T 1: 58,002,933 Q140* probably null Het
Sh3rf3 A G 10: 58,984,144 D259G probably damaging Het
Slc27a3 C A 3: 90,385,470 D631Y probably damaging Het
Slc7a10 T C 7: 35,186,590 S37P possibly damaging Het
Slco6d1 A G 1: 98,421,467 T88A probably benign Het
Smad4 A T 18: 73,677,746 S56T possibly damaging Het
Smarcd1 A G 15: 99,707,885 I346V possibly damaging Het
Spast C T 17: 74,368,840 P260S probably benign Het
Sprr2i A T 3: 92,408,710 probably benign Het
Sptbn5 A G 2: 120,047,135 probably benign Het
Taar9 A T 10: 24,109,240 Y99N probably damaging Het
Trappc10 A T 10: 78,209,450 M468K possibly damaging Het
Trim66 T C 7: 109,460,738 R814G probably benign Het
Tspan31 A G 10: 127,068,358 C157R probably damaging Het
Vmn2r90 A G 17: 17,733,236 D554G possibly damaging Het
Vmn2r91 A T 17: 18,085,265 D70V probably damaging Het
Wdfy4 C T 14: 33,108,692 G928R probably damaging Het
Wdr60 A T 12: 116,246,727 Y314* probably null Het
Zfp346 G T 13: 55,113,704 K102N probably damaging Het
Zmym4 G A 4: 126,895,306 P1002S probably damaging Het
Other mutations in Ppm1g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02517:Ppm1g APN 5 31208081 missense probably damaging 1.00
R0843:Ppm1g UTSW 5 31207551 splice site probably benign
R1483:Ppm1g UTSW 5 31203121 missense probably benign 0.45
R1750:Ppm1g UTSW 5 31206216 missense probably damaging 1.00
R5611:Ppm1g UTSW 5 31206097 missense probably damaging 1.00
R5776:Ppm1g UTSW 5 31205110 missense probably benign 0.01
R6274:Ppm1g UTSW 5 31206406 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCCCTCTTTGTAATGGGCTG -3'
(R):5'- TCTTGTATTAGCAAGGACAAGCC -3'

Sequencing Primer
(F):5'- CCTCTTTGTAATGGGCTGAGGAAAG -3'
(R):5'- GGTTCAAACCCCATGGCTAAACTG -3'
Posted On2018-05-24