Incidental Mutation 'R6452:Myh8'
ID519420
Institutional Source Beutler Lab
Gene Symbol Myh8
Ensembl Gene ENSMUSG00000055775
Gene Namemyosin, heavy polypeptide 8, skeletal muscle, perinatal
SynonymsMyhsp, 4832426G23Rik, MyHC-pn, Myhs-p
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.777) question?
Stock #R6452 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location67277124-67308634 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 67292449 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 718 (Y718F)
Ref Sequence ENSEMBL: ENSMUSP00000019625 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019625]
Predicted Effect probably benign
Transcript: ENSMUST00000019625
AA Change: Y718F

PolyPhen 2 Score 0.266 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000019625
Gene: ENSMUSG00000055775
AA Change: Y718F

DomainStartEndE-ValueType
Pfam:Myosin_N 37 76 2.1e-13 PFAM
MYSc 82 782 N/A SMART
IQ 783 805 5.44e-3 SMART
Pfam:Myosin_tail_1 846 1927 2.4e-164 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000108686
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139052
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a myosin heavy chain. The encoded protein forms a hexamer with two heavy chains, two alkali light chains, and two regulatory light chain components. This complex functions in muscle contraction. This gene is located in a cluster of related genes on chromosome 11. [provided by RefSeq, Jun 2013]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F07Rik C A 2: 173,527,907 F71L probably benign Het
3110070M22Rik A G 13: 119,488,115 probably benign Het
Alox12e A T 11: 70,320,005 V296E probably damaging Het
Arntl2 G A 6: 146,823,207 E400K probably benign Het
Ccdc171 A G 4: 83,864,290 D1273G probably damaging Het
Cetn3 C T 13: 81,784,678 R19* probably null Het
Chd6 G T 2: 160,965,498 P1932H possibly damaging Het
Cyp2d34 A T 15: 82,616,089 I483N probably benign Het
Dglucy T C 12: 100,835,209 V71A possibly damaging Het
Dhx35 A G 2: 158,831,687 E346G probably damaging Het
Dnajc14 A G 10: 128,807,490 E427G probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Fam57a G T 11: 76,207,146 G60* probably null Het
Fasn G T 11: 120,815,411 Q1036K probably damaging Het
Fermt3 A T 19: 7,014,737 F92I probably benign Het
Filip1l C A 16: 57,506,800 D64E possibly damaging Het
Fnbp1l A G 3: 122,544,549 F491S probably damaging Het
Fzd2 T G 11: 102,604,985 V85G probably damaging Het
Gjd4 G A 18: 9,280,457 T207M possibly damaging Het
Gm12794 T C 4: 101,941,443 Y204H probably benign Het
Gm32742 T C 9: 51,146,190 E1096G probably damaging Het
Itgb3 T A 11: 104,633,464 L142* probably null Het
Kctd21 T A 7: 97,347,662 I114N probably benign Het
Klra4 G T 6: 130,065,366 probably null Het
Larp4b T C 13: 9,147,467 V240A probably damaging Het
Lrriq4 T C 3: 30,655,733 S409P probably damaging Het
Magel2 A G 7: 62,380,384 E1012G unknown Het
Mmp24 A T 2: 155,815,753 D521V possibly damaging Het
Mocos A G 18: 24,695,941 I768V probably benign Het
Mprip A T 11: 59,752,783 E553V probably damaging Het
Myo7a C T 7: 98,073,167 V1184M probably benign Het
Neb A T 2: 52,179,483 D5775E probably benign Het
Olfr1564 T C 17: 33,215,945 N133S probably benign Het
Olfr490 A G 7: 108,286,893 S78P probably damaging Het
Prl8a2 T C 13: 27,352,797 I134T probably benign Het
Qrich2 G A 11: 116,455,888 T1370I probably benign Het
Rabgap1l A G 1: 160,453,761 L630P probably damaging Het
Ranbp2 G T 10: 58,478,157 L1566F probably benign Het
Rnf43 T A 11: 87,732,253 W727R probably damaging Het
Rundc3b A T 5: 8,579,175 probably null Het
Samm50 T G 15: 84,204,097 probably benign Het
Sema4f G A 6: 82,917,662 A476V probably benign Het
Slc4a4 A G 5: 89,228,980 N1031S probably benign Het
Slc4a9 A G 18: 36,531,459 Y390C probably damaging Het
Slco6d1 C A 1: 98,421,212 Q3K probably benign Het
Smim1 T C 4: 154,023,614 probably benign Het
Spg7 A G 8: 123,079,423 K291E possibly damaging Het
Sppl2c A T 11: 104,188,191 T606S probably benign Het
Tex15 A G 8: 33,572,816 D758G probably damaging Het
Tigd5 A T 15: 75,911,438 R550* probably null Het
Tnrc18 A C 5: 142,727,012 L2594R probably damaging Het
Vezf1 A G 11: 88,081,670 T468A possibly damaging Het
Vmn1r210 T A 13: 22,827,670 I149F probably damaging Het
Vmn2r96 A C 17: 18,583,855 T264P probably benign Het
Zfp217 C G 2: 170,119,294 S371T probably benign Het
Zfp442 G A 2: 150,408,108 H568Y probably damaging Het
Zfp53 A C 17: 21,509,613 H636P probably damaging Het
Zscan4d C T 7: 11,162,072 C457Y probably damaging Het
Other mutations in Myh8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Myh8 APN 11 67283818 missense probably damaging 0.97
IGL01020:Myh8 APN 11 67283403 missense probably damaging 0.99
IGL01348:Myh8 APN 11 67297780 missense probably damaging 1.00
IGL01382:Myh8 APN 11 67301973 missense probably damaging 1.00
IGL01454:Myh8 APN 11 67283596 missense probably damaging 1.00
IGL01457:Myh8 APN 11 67292679 missense probably benign 0.00
IGL01472:Myh8 APN 11 67288379 splice site probably benign
IGL01473:Myh8 APN 11 67301825 critical splice donor site probably null
IGL01613:Myh8 APN 11 67301710 missense probably benign 0.11
IGL01763:Myh8 APN 11 67286419 missense probably benign 0.01
IGL01828:Myh8 APN 11 67303826 missense possibly damaging 0.82
IGL01862:Myh8 APN 11 67289694 nonsense probably null
IGL01905:Myh8 APN 11 67284651 missense possibly damaging 0.90
IGL02280:Myh8 APN 11 67283372 unclassified probably benign
IGL02386:Myh8 APN 11 67294440 missense probably damaging 0.99
IGL02449:Myh8 APN 11 67294614 critical splice donor site probably null
IGL02500:Myh8 APN 11 67305710 missense probably benign 0.00
IGL02745:Myh8 APN 11 67297501 missense possibly damaging 0.88
IGL02799:Myh8 APN 11 67301592 splice site probably benign
IGL03063:Myh8 APN 11 67288205 missense probably benign 0.00
IGL03223:Myh8 APN 11 67283818 missense probably damaging 0.97
IGL03336:Myh8 APN 11 67284702 missense probably damaging 1.00
IGL03338:Myh8 APN 11 67298346 missense probably damaging 1.00
IGL03351:Myh8 APN 11 67303913 missense possibly damaging 0.94
IGL03392:Myh8 APN 11 67294418 missense probably damaging 1.00
PIT4354001:Myh8 UTSW 11 67289630 missense probably benign 0.01
R0012:Myh8 UTSW 11 67300021 missense probably benign 0.02
R0016:Myh8 UTSW 11 67298525 missense probably damaging 1.00
R0016:Myh8 UTSW 11 67298525 missense probably damaging 1.00
R0115:Myh8 UTSW 11 67306264 splice site probably benign
R0131:Myh8 UTSW 11 67292188 missense probably damaging 0.96
R0131:Myh8 UTSW 11 67292188 missense probably damaging 0.96
R0132:Myh8 UTSW 11 67292188 missense probably damaging 0.96
R0238:Myh8 UTSW 11 67301692 missense probably benign 0.00
R0238:Myh8 UTSW 11 67301692 missense probably benign 0.00
R0239:Myh8 UTSW 11 67301692 missense probably benign 0.00
R0239:Myh8 UTSW 11 67301692 missense probably benign 0.00
R0393:Myh8 UTSW 11 67306017 splice site probably benign
R0453:Myh8 UTSW 11 67292905 missense probably benign 0.03
R0454:Myh8 UTSW 11 67303765 nonsense probably null
R0466:Myh8 UTSW 11 67298579 missense probably benign 0.01
R0487:Myh8 UTSW 11 67302011 missense probably benign
R0511:Myh8 UTSW 11 67284507 missense probably benign 0.01
R0557:Myh8 UTSW 11 67301798 missense possibly damaging 0.88
R0589:Myh8 UTSW 11 67298627 missense probably benign 0.00
R0658:Myh8 UTSW 11 67284532 critical splice donor site probably null
R0782:Myh8 UTSW 11 67289754 missense probably benign 0.16
R0829:Myh8 UTSW 11 67283500 unclassified probably benign
R0845:Myh8 UTSW 11 67286264 missense probably damaging 1.00
R0930:Myh8 UTSW 11 67305998 missense possibly damaging 0.93
R0972:Myh8 UTSW 11 67297759 missense probably damaging 1.00
R1132:Myh8 UTSW 11 67297131 nonsense probably null
R1417:Myh8 UTSW 11 67306185 missense probably damaging 1.00
R1478:Myh8 UTSW 11 67292725 missense probably benign 0.23
R1497:Myh8 UTSW 11 67289812 missense probably benign 0.00
R1605:Myh8 UTSW 11 67301671 missense probably damaging 0.99
R1701:Myh8 UTSW 11 67280138 missense probably damaging 1.00
R1950:Myh8 UTSW 11 67279004 missense possibly damaging 0.75
R1989:Myh8 UTSW 11 67292724 missense probably benign 0.00
R2010:Myh8 UTSW 11 67297164 nonsense probably null
R2095:Myh8 UTSW 11 67286224 missense probably benign 0.00
R2132:Myh8 UTSW 11 67292876 missense probably damaging 1.00
R2152:Myh8 UTSW 11 67294469 missense probably damaging 0.97
R2229:Myh8 UTSW 11 67308348 missense probably damaging 0.98
R2302:Myh8 UTSW 11 67286239 missense probably damaging 1.00
R2364:Myh8 UTSW 11 67294518 missense probably benign 0.03
R2429:Myh8 UTSW 11 67303897 missense probably benign 0.21
R2880:Myh8 UTSW 11 67297264 missense probably damaging 0.97
R3692:Myh8 UTSW 11 67301918 missense probably damaging 0.98
R3756:Myh8 UTSW 11 67284617 unclassified probably benign
R3924:Myh8 UTSW 11 67297137 missense probably damaging 0.99
R4172:Myh8 UTSW 11 67292421 missense probably damaging 1.00
R4255:Myh8 UTSW 11 67299734 missense probably benign
R4621:Myh8 UTSW 11 67286258 missense probably damaging 1.00
R4623:Myh8 UTSW 11 67286258 missense probably damaging 1.00
R4790:Myh8 UTSW 11 67279963 missense probably damaging 0.99
R4914:Myh8 UTSW 11 67292684 missense probably damaging 1.00
R5074:Myh8 UTSW 11 67305916 missense possibly damaging 0.79
R5119:Myh8 UTSW 11 67298358 missense probably damaging 1.00
R5159:Myh8 UTSW 11 67288353 missense probably damaging 0.99
R5229:Myh8 UTSW 11 67284484 missense probably damaging 0.96
R5320:Myh8 UTSW 11 67286263 missense probably damaging 1.00
R5455:Myh8 UTSW 11 67301418 missense possibly damaging 0.59
R5523:Myh8 UTSW 11 67305962 missense possibly damaging 0.95
R5540:Myh8 UTSW 11 67286440 missense probably benign 0.00
R5726:Myh8 UTSW 11 67294566 missense possibly damaging 0.79
R5770:Myh8 UTSW 11 67297200 missense probably damaging 1.00
R6135:Myh8 UTSW 11 67297500 missense possibly damaging 0.51
R6253:Myh8 UTSW 11 67301967 missense probably benign 0.06
R6318:Myh8 UTSW 11 67299341 missense probably benign 0.00
R6432:Myh8 UTSW 11 67298579 missense probably benign 0.01
R6452:Myh8 UTSW 11 67305739 missense possibly damaging 0.88
R6512:Myh8 UTSW 11 67289662 nonsense probably null
R6714:Myh8 UTSW 11 67306949 missense probably damaging 1.00
R6842:Myh8 UTSW 11 67284655 missense probably damaging 1.00
R7007:Myh8 UTSW 11 67288316 missense probably benign 0.03
R7025:Myh8 UTSW 11 67297539 missense probably benign 0.02
R7086:Myh8 UTSW 11 67292627 splice site probably null
R7098:Myh8 UTSW 11 67279053 missense probably benign 0.03
T0722:Myh8 UTSW 11 67304436 missense probably benign 0.41
Z1088:Myh8 UTSW 11 67298592 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAAACGAAGACTCCCGGTAAG -3'
(R):5'- CCCTCTGGAATAGCACTTGC -3'

Sequencing Primer
(F):5'- GACTCCCGGTAAGACACAAAG -3'
(R):5'- CAGTTAAACACATAAGGGATGCTC -3'
Posted On2018-05-24