Incidental Mutation 'R6452:Vezf1'
ID519425
Institutional Source Beutler Lab
Gene Symbol Vezf1
Ensembl Gene ENSMUSG00000018377
Gene Namevascular endothelial zinc finger 1
Synonymsdb1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6452 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location88068279-88084729 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 88081670 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 468 (T468A)
Ref Sequence ENSEMBL: ENSMUSP00000018521 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018521] [ENSMUST00000143052]
Predicted Effect possibly damaging
Transcript: ENSMUST00000018521
AA Change: T468A

PolyPhen 2 Score 0.660 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000018521
Gene: ENSMUSG00000018377
AA Change: T468A

DomainStartEndE-ValueType
low complexity region 11 24 N/A INTRINSIC
ZnF_C2H2 74 96 3.83e-2 SMART
low complexity region 137 172 N/A INTRINSIC
ZnF_C2H2 174 196 6.78e-3 SMART
ZnF_C2H2 202 224 2.99e-4 SMART
ZnF_C2H2 232 255 1.1e-2 SMART
ZnF_C2H2 261 283 3.16e-3 SMART
ZnF_C2H2 287 308 2.61e1 SMART
low complexity region 335 351 N/A INTRINSIC
low complexity region 368 379 N/A INTRINSIC
low complexity region 384 397 N/A INTRINSIC
low complexity region 454 472 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143052
AA Change: T286A

PolyPhen 2 Score 0.431 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000114394
Gene: ENSMUSG00000018377
AA Change: T286A

DomainStartEndE-ValueType
ZnF_C2H2 14 36 2.99e-4 SMART
ZnF_C2H2 44 67 1.1e-2 SMART
ZnF_C2H2 73 101 2.47e1 SMART
ZnF_C2H2 105 126 2.61e1 SMART
low complexity region 153 169 N/A INTRINSIC
low complexity region 186 197 N/A INTRINSIC
low complexity region 202 215 N/A INTRINSIC
low complexity region 272 290 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Transcriptional regulatory proteins containing tandemly repeated zinc finger domains are thought to be involved in both normal and abnormal cellular proliferation and differentiation. ZNF161 is a C2H2-type zinc finger protein (Koyano-Nakagawa et al., 1994 [PubMed 8035792]). See MIM 603971 for general information on zinc finger proteins.[supplied by OMIM, Sep 2008]
PHENOTYPE: Homozygous null mice die at midgestation due to angiogenic remodeling defects and loss of vascular integrity leading to hemorrhaging in the head, heart and trunk. One fifth of heterozygous null embryos show lymphatic hypervascularization associated with hemorrhaging and edema in the jugular region. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F07Rik C A 2: 173,527,907 F71L probably benign Het
3110070M22Rik A G 13: 119,488,115 probably benign Het
Alox12e A T 11: 70,320,005 V296E probably damaging Het
Arntl2 G A 6: 146,823,207 E400K probably benign Het
Ccdc171 A G 4: 83,864,290 D1273G probably damaging Het
Cetn3 C T 13: 81,784,678 R19* probably null Het
Chd6 G T 2: 160,965,498 P1932H possibly damaging Het
Cyp2d34 A T 15: 82,616,089 I483N probably benign Het
Dglucy T C 12: 100,835,209 V71A possibly damaging Het
Dhx35 A G 2: 158,831,687 E346G probably damaging Het
Dnajc14 A G 10: 128,807,490 E427G probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Fam57a G T 11: 76,207,146 G60* probably null Het
Fasn G T 11: 120,815,411 Q1036K probably damaging Het
Fermt3 A T 19: 7,014,737 F92I probably benign Het
Filip1l C A 16: 57,506,800 D64E possibly damaging Het
Fnbp1l A G 3: 122,544,549 F491S probably damaging Het
Fzd2 T G 11: 102,604,985 V85G probably damaging Het
Gjd4 G A 18: 9,280,457 T207M possibly damaging Het
Gm12794 T C 4: 101,941,443 Y204H probably benign Het
Gm32742 T C 9: 51,146,190 E1096G probably damaging Het
Itgb3 T A 11: 104,633,464 L142* probably null Het
Kctd21 T A 7: 97,347,662 I114N probably benign Het
Klra4 G T 6: 130,065,366 probably null Het
Larp4b T C 13: 9,147,467 V240A probably damaging Het
Lrriq4 T C 3: 30,655,733 S409P probably damaging Het
Magel2 A G 7: 62,380,384 E1012G unknown Het
Mmp24 A T 2: 155,815,753 D521V possibly damaging Het
Mocos A G 18: 24,695,941 I768V probably benign Het
Mprip A T 11: 59,752,783 E553V probably damaging Het
Myh8 A T 11: 67,292,449 Y718F probably benign Het
Myh8 A T 11: 67,305,739 I1762F possibly damaging Het
Myo7a C T 7: 98,073,167 V1184M probably benign Het
Neb A T 2: 52,179,483 D5775E probably benign Het
Olfr1564 T C 17: 33,215,945 N133S probably benign Het
Olfr490 A G 7: 108,286,893 S78P probably damaging Het
Prl8a2 T C 13: 27,352,797 I134T probably benign Het
Qrich2 G A 11: 116,455,888 T1370I probably benign Het
Rabgap1l A G 1: 160,453,761 L630P probably damaging Het
Ranbp2 G T 10: 58,478,157 L1566F probably benign Het
Rnf43 T A 11: 87,732,253 W727R probably damaging Het
Rundc3b A T 5: 8,579,175 probably null Het
Samm50 T G 15: 84,204,097 probably benign Het
Sema4f G A 6: 82,917,662 A476V probably benign Het
Slc4a4 A G 5: 89,228,980 N1031S probably benign Het
Slc4a9 A G 18: 36,531,459 Y390C probably damaging Het
Slco6d1 C A 1: 98,421,212 Q3K probably benign Het
Smim1 T C 4: 154,023,614 probably benign Het
Spg7 A G 8: 123,079,423 K291E possibly damaging Het
Sppl2c A T 11: 104,188,191 T606S probably benign Het
Tex15 A G 8: 33,572,816 D758G probably damaging Het
Tigd5 A T 15: 75,911,438 R550* probably null Het
Tnrc18 A C 5: 142,727,012 L2594R probably damaging Het
Vmn1r210 T A 13: 22,827,670 I149F probably damaging Het
Vmn2r96 A C 17: 18,583,855 T264P probably benign Het
Zfp217 C G 2: 170,119,294 S371T probably benign Het
Zfp442 G A 2: 150,408,108 H568Y probably damaging Het
Zfp53 A C 17: 21,509,613 H636P probably damaging Het
Zscan4d C T 7: 11,162,072 C457Y probably damaging Het
Other mutations in Vezf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00531:Vezf1 APN 11 88073494 missense probably benign 0.14
IGL00576:Vezf1 APN 11 88073644 nonsense probably null
IGL02683:Vezf1 APN 11 88076327 missense probably benign 0.36
IGL02700:Vezf1 APN 11 88073303 missense probably damaging 0.97
IGL02701:Vezf1 APN 11 88076221 nonsense probably null
R0541:Vezf1 UTSW 11 88081577 missense possibly damaging 0.77
R0591:Vezf1 UTSW 11 88068435 critical splice donor site probably benign
R0592:Vezf1 UTSW 11 88068435 critical splice donor site probably benign
R0725:Vezf1 UTSW 11 88073330 missense probably benign 0.04
R0758:Vezf1 UTSW 11 88068435 critical splice donor site probably benign
R0803:Vezf1 UTSW 11 88068435 critical splice donor site probably benign
R0853:Vezf1 UTSW 11 88068435 critical splice donor site probably benign
R0854:Vezf1 UTSW 11 88068435 critical splice donor site probably benign
R1491:Vezf1 UTSW 11 88073747 missense probably damaging 1.00
R1605:Vezf1 UTSW 11 88076299 missense possibly damaging 0.75
R1781:Vezf1 UTSW 11 88081621 missense probably benign 0.28
R3898:Vezf1 UTSW 11 88076173 missense probably benign
R4656:Vezf1 UTSW 11 88074667 missense probably damaging 1.00
R4868:Vezf1 UTSW 11 88074694 missense probably damaging 1.00
R5946:Vezf1 UTSW 11 88073734 nonsense probably null
R6190:Vezf1 UTSW 11 88076186 missense probably benign 0.02
R6258:Vezf1 UTSW 11 88081500 missense probably damaging 1.00
R6260:Vezf1 UTSW 11 88081500 missense probably damaging 1.00
R6680:Vezf1 UTSW 11 88081584 missense probably benign 0.23
R6983:Vezf1 UTSW 11 88073319 missense possibly damaging 0.88
R7086:Vezf1 UTSW 11 88078538 missense probably benign 0.00
R7322:Vezf1 UTSW 11 88081584 missense possibly damaging 0.68
R7443:Vezf1 UTSW 11 88074663 missense probably damaging 1.00
X0019:Vezf1 UTSW 11 88068435 critical splice donor site probably benign
X0067:Vezf1 UTSW 11 88081728 missense probably benign 0.24
Predicted Primers PCR Primer
(F):5'- GTCAAACCCAGTCACAGTGG -3'
(R):5'- AAAACCTCCCAATTTCATAGTCTGC -3'

Sequencing Primer
(F):5'- TCACAGTGGCAGCTGCAATG -3'
(R):5'- AATCAACTAAGGTTAAGTTGCTGG -3'
Posted On2018-05-24