Incidental Mutation 'R6455:Tnn'
ID519516
Institutional Source Beutler Lab
Gene Symbol Tnn
Ensembl Gene ENSMUSG00000026725
Gene Nametenascin N
SynonymsTnw, tenascin-W
MMRRC Submission
Accession Numbers

Genbank: NM_177839.3; Ensembl: ENSMUST00000039178

Is this an essential gene? Possibly non essential (E-score: 0.343) question?
Stock #R6455 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location160085029-160153580 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 160114719 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 806 (V806M)
Ref Sequence ENSEMBL: ENSMUSP00000115685 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039178] [ENSMUST00000131919]
Predicted Effect probably damaging
Transcript: ENSMUST00000039178
AA Change: V1070M

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000039452
Gene: ENSMUSG00000026725
AA Change: V1070M

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
coiled coil region 100 132 N/A INTRINSIC
EGF_like 170 198 3.5e1 SMART
EGF 201 229 2.29e1 SMART
EGF_like 232 260 2.86e1 SMART
FN3 262 341 1.81e-8 SMART
FN3 351 432 1.08e-6 SMART
FN3 443 521 1.19e-8 SMART
FN3 531 608 2.64e-10 SMART
FN3 619 696 1.6e-9 SMART
FN3 707 784 9.04e-9 SMART
FN3 795 872 7.34e-9 SMART
FN3 883 960 9.04e-9 SMART
FN3 971 1048 1.07e-10 SMART
FN3 1059 1136 7.57e-11 SMART
FN3 1147 1224 4.59e-10 SMART
FN3 1235 1312 1.95e-4 SMART
FBG 1327 1539 1.16e-114 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000131919
AA Change: V806M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115685
Gene: ENSMUSG00000026725
AA Change: V806M

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
coiled coil region 100 132 N/A INTRINSIC
EGF_like 170 198 3.5e1 SMART
EGF 201 229 2.29e1 SMART
EGF_like 232 260 2.86e1 SMART
FN3 262 341 1.81e-8 SMART
FN3 351 432 1.08e-6 SMART
FN3 443 521 1.19e-8 SMART
FN3 531 608 2.64e-10 SMART
FN3 619 696 1.6e-9 SMART
FN3 707 784 9.04e-9 SMART
FN3 795 872 7.57e-11 SMART
FN3 883 960 4.59e-10 SMART
FN3 971 1048 1.95e-4 SMART
FBG 1063 1275 1.16e-114 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.7%
Validation Efficiency 96% (70/73)
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230110F15Rik T A 9: 35,844,055 K3* probably null Het
A430078G23Rik A T 8: 3,388,753 Y370F probably benign Het
Abca1 T C 4: 53,042,376 R1899G probably damaging Het
Abca6 C T 11: 110,241,581 G296D probably damaging Het
Abcb5 A T 12: 118,890,549 probably null Het
Adam28 T G 14: 68,633,208 T339P probably damaging Het
Adcy10 C G 1: 165,518,374 Q331E probably damaging Het
Aldh1a2 A T 9: 71,252,914 probably null Het
Alms1 T A 6: 85,696,657 I3078N probably damaging Het
Amtn A T 5: 88,380,280 N71Y probably damaging Het
Arid4a T C 12: 71,075,088 S748P probably benign Het
Atp2b1 C A 10: 99,016,980 Q108K possibly damaging Het
Bcdin3d T C 15: 99,470,949 D123G probably benign Het
Capn15 A G 17: 25,965,436 S24P probably damaging Het
Cc2d2a T A 5: 43,739,412 S1550R possibly damaging Het
Ccdc7a C T 8: 128,832,610 V1174M probably damaging Het
Cd22 T A 7: 30,876,153 I155F probably damaging Het
Ceacam3 T C 7: 17,161,938 I611T possibly damaging Het
Chrna1 C T 2: 73,566,836 D370N possibly damaging Het
Diexf G T 1: 193,128,376 D106E probably benign Het
Dlg2 C A 7: 92,444,508 probably null Het
Dll4 A T 2: 119,333,795 probably null Het
Eif5b T C 1: 38,019,027 S137P probably benign Het
Epn2 A T 11: 61,533,641 M250K probably damaging Het
Fat2 T A 11: 55,270,457 Q3149L probably damaging Het
Fbxl13 G A 5: 21,556,814 S341F probably benign Het
Gm15922 T A 7: 3,738,931 Y150F probably benign Het
Gm5141 A T 13: 62,774,783 C191S probably damaging Het
Gm5150 C T 3: 15,990,651 G137S probably damaging Het
Gm5346 T A 8: 43,626,152 H345L probably damaging Het
Gpr75 C T 11: 30,891,529 R145W probably damaging Het
Heatr5b G A 17: 78,753,073 H2058Y probably benign Het
Ina G A 19: 47,023,561 E473K probably benign Het
Irx6 T C 8: 92,676,072 S22P probably benign Het
Itpr1 T A 6: 108,417,972 M32K probably damaging Het
Jmjd1c T A 10: 67,226,016 S1383T probably benign Het
Lclat1 T A 17: 73,161,833 S3T probably damaging Het
Llgl1 G A 11: 60,709,660 V612M probably damaging Het
Mios A G 6: 8,231,239 R708G probably benign Het
Mphosph8 T C 14: 56,688,486 L636P probably damaging Het
Mrgpra2b T A 7: 47,464,145 N254Y probably damaging Het
Myo7a C T 7: 98,073,167 V1184M probably benign Het
Myog G A 1: 134,290,488 D145N probably benign Het
Nat10 T A 2: 103,739,886 I371F possibly damaging Het
Neb A T 2: 52,167,644 Y229* probably null Het
Nlrp6 T A 7: 140,927,509 I896K possibly damaging Het
Olfr235 T C 19: 12,268,706 S159P probably damaging Het
Olfr551 G A 7: 102,588,671 A24V probably benign Het
Olfr740 A T 14: 50,453,585 I178L possibly damaging Het
Pcdhgc5 A C 18: 37,821,248 E525A probably damaging Het
Pkd2 C A 5: 104,459,924 D96E probably benign Het
Prtg A G 9: 72,907,856 D1022G probably damaging Het
Ptpn13 T C 5: 103,541,284 M981T probably benign Het
Rc3h2 C A 2: 37,409,470 A183S probably damaging Het
Rorb A T 19: 18,960,492 I270N probably damaging Het
Rpgrip1 C T 14: 52,141,189 R524W probably damaging Het
Slc25a10 T C 11: 120,495,205 V124A probably damaging Het
Slc40a1 T A 1: 45,918,947 I109F probably damaging Het
Spen G A 4: 141,475,509 R1936W probably damaging Het
St6gal2 T A 17: 55,482,513 Y183N probably benign Het
Svil A G 18: 5,056,629 K588E possibly damaging Het
Tas2r122 C T 6: 132,711,663 W89* probably null Het
Tbxas1 T A 6: 38,952,145 probably benign Het
Tia1 T A 6: 86,420,378 I111N probably damaging Het
Tlr9 T A 9: 106,223,999 L163H probably damaging Het
Traf5 G A 1: 191,999,926 A318V probably benign Het
Ttc3 T A 16: 94,418,623 M1K probably null Het
Vmn1r192 T A 13: 22,187,830 R73S probably benign Het
Vmn1r71 T C 7: 10,748,404 Y53C probably benign Het
Vmn2r34 T A 7: 7,683,583 N372Y probably damaging Het
Wbp2 A T 11: 116,079,753 S229R probably damaging Het
Wdr18 C T 10: 79,965,281 T176I probably damaging Het
Other mutations in Tnn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Tnn APN 1 160125451 missense possibly damaging 0.65
IGL00433:Tnn APN 1 160098206 splice site probably benign
IGL00858:Tnn APN 1 160088392 critical splice donor site probably null
IGL00939:Tnn APN 1 160147530 missense probably damaging 1.00
IGL01569:Tnn APN 1 160120554 missense possibly damaging 0.51
IGL01591:Tnn APN 1 160125574 missense probably damaging 1.00
IGL01628:Tnn APN 1 160147602 missense possibly damaging 0.89
IGL01811:Tnn APN 1 160107135 missense probably damaging 1.00
IGL01813:Tnn APN 1 160088438 missense probably damaging 1.00
IGL02340:Tnn APN 1 160145205 missense probably benign 0.00
IGL02488:Tnn APN 1 160140593 missense probably benign 0.21
IGL02535:Tnn APN 1 160122652 splice site probably null
IGL02563:Tnn APN 1 160114553 missense probably damaging 1.00
IGL02572:Tnn APN 1 160086107 missense probably damaging 1.00
IGL02740:Tnn APN 1 160140777 splice site probably benign
IGL02818:Tnn APN 1 160116278 missense possibly damaging 0.86
IGL03284:Tnn APN 1 160125452 missense probably benign 0.01
1mM(1):Tnn UTSW 1 160097341 missense probably damaging 1.00
PIT4305001:Tnn UTSW 1 160086077 missense possibly damaging 0.91
R0023:Tnn UTSW 1 160104928 missense probably benign 0.00
R0234:Tnn UTSW 1 160088466 missense probably damaging 1.00
R0234:Tnn UTSW 1 160088466 missense probably damaging 1.00
R0316:Tnn UTSW 1 160120567 missense possibly damaging 0.93
R0492:Tnn UTSW 1 160120757 missense probably damaging 0.99
R0547:Tnn UTSW 1 160116337 intron probably benign
R1067:Tnn UTSW 1 160125398 missense probably damaging 1.00
R1563:Tnn UTSW 1 160125415 missense probably damaging 1.00
R1565:Tnn UTSW 1 160097265 missense probably damaging 1.00
R1615:Tnn UTSW 1 160118408 missense possibly damaging 0.93
R1637:Tnn UTSW 1 160147600 missense probably damaging 1.00
R1707:Tnn UTSW 1 160145144 missense probably damaging 1.00
R1758:Tnn UTSW 1 160147584 missense possibly damaging 0.61
R1797:Tnn UTSW 1 160140688 missense probably damaging 1.00
R1847:Tnn UTSW 1 160116182 missense possibly damaging 0.51
R1925:Tnn UTSW 1 160097229 missense probably damaging 1.00
R2182:Tnn UTSW 1 160140600 synonymous probably null
R2196:Tnn UTSW 1 160097228 nonsense probably null
R2225:Tnn UTSW 1 160147465 missense probably damaging 1.00
R2227:Tnn UTSW 1 160147465 missense probably damaging 1.00
R2286:Tnn UTSW 1 160110509 missense possibly damaging 0.89
R2850:Tnn UTSW 1 160139287 missense probably benign 0.00
R3110:Tnn UTSW 1 160116286 missense possibly damaging 0.71
R3111:Tnn UTSW 1 160107055 missense probably damaging 0.98
R3112:Tnn UTSW 1 160116286 missense possibly damaging 0.71
R3729:Tnn UTSW 1 160146240 missense probably damaging 1.00
R4183:Tnn UTSW 1 160097355 missense probably damaging 1.00
R4439:Tnn UTSW 1 160116080 missense probably benign
R4441:Tnn UTSW 1 160116080 missense probably benign
R4588:Tnn UTSW 1 160145111 missense probably benign 0.25
R4646:Tnn UTSW 1 160146042 missense probably benign
R4647:Tnn UTSW 1 160146042 missense probably benign
R4648:Tnn UTSW 1 160146042 missense probably benign
R4701:Tnn UTSW 1 160147768 missense possibly damaging 0.72
R4703:Tnn UTSW 1 160116245 missense possibly damaging 0.84
R4737:Tnn UTSW 1 160146089 missense probably damaging 1.00
R4801:Tnn UTSW 1 160145033 missense possibly damaging 0.90
R4802:Tnn UTSW 1 160145033 missense possibly damaging 0.90
R4868:Tnn UTSW 1 160130873 missense possibly damaging 0.64
R4977:Tnn UTSW 1 160120618 missense probably damaging 1.00
R5011:Tnn UTSW 1 160126379 missense possibly damaging 0.89
R5026:Tnn UTSW 1 160146137 missense probably benign 0.00
R5027:Tnn UTSW 1 160145211 missense probably damaging 1.00
R5049:Tnn UTSW 1 160140738 missense probably benign 0.00
R5119:Tnn UTSW 1 160120552 missense probably damaging 0.98
R5128:Tnn UTSW 1 160122894 missense probably damaging 0.98
R5234:Tnn UTSW 1 160144999 missense possibly damaging 0.95
R5398:Tnn UTSW 1 160147522 missense probably benign 0.00
R5424:Tnn UTSW 1 160122702 missense possibly damaging 0.69
R5452:Tnn UTSW 1 160110261 missense probably benign 0.13
R5466:Tnn UTSW 1 160120536 missense possibly damaging 0.93
R6022:Tnn UTSW 1 160110358 missense probably benign 0.00
R6062:Tnn UTSW 1 160098278 missense probably damaging 1.00
R6086:Tnn UTSW 1 160086120 missense probably damaging 1.00
R6132:Tnn UTSW 1 160146071 missense probably damaging 0.96
R6324:Tnn UTSW 1 160145204 missense probably damaging 0.96
R6563:Tnn UTSW 1 160088398 missense probably damaging 1.00
R6650:Tnn UTSW 1 160114583 missense probably damaging 1.00
R6806:Tnn UTSW 1 160120708 missense possibly damaging 0.95
R6810:Tnn UTSW 1 160104842 missense probably damaging 1.00
R7157:Tnn UTSW 1 160126377 nonsense probably null
R7243:Tnn UTSW 1 160107117 missense probably benign 0.07
X0019:Tnn UTSW 1 160086146 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTTGGACCGTGTACTCCAC -3'
(R):5'- CTGCACTCTGAGCCTCTTAATG -3'

Sequencing Primer
(F):5'- GTACTCCACACCCGGTCTCAG -3'
(R):5'- GTGTTTACACATAGGCACACATAGG -3'
Posted On2018-05-24