Incidental Mutation 'R6455:Wdr18'
ID519558
Institutional Source Beutler Lab
Gene Symbol Wdr18
Ensembl Gene ENSMUSG00000035754
Gene NameWD repeat domain 18
Synonyms2310012I10Rik
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_175450.4; MGI: 2158400

Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock #R6455 (G1)
Quality Score105.008
Status Validated
Chromosome10
Chromosomal Location79960152-79970203 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 79965281 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 176 (T176I)
Ref Sequence ENSEMBL: ENSMUSP00000041049 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045247]
Predicted Effect probably damaging
Transcript: ENSMUST00000045247
AA Change: T176I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000041049
Gene: ENSMUSG00000035754
AA Change: T176I

DomainStartEndE-ValueType
Blast:WD40 27 66 3e-17 BLAST
WD40 70 107 1.48e1 SMART
WD40 110 149 1.24e-4 SMART
WD40 161 202 2.49e-1 SMART
WD40 205 243 2.05e1 SMART
WD40 258 297 2.32e-9 SMART
low complexity region 353 367 N/A INTRINSIC
Pfam:WD40_alt 383 429 4.3e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218449
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218515
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220249
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220272
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.7%
Validation Efficiency 96% (70/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(8) : Targeted(1) Gene trapped(7)

Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230110F15Rik T A 9: 35,844,055 K3* probably null Het
A430078G23Rik A T 8: 3,388,753 Y370F probably benign Het
Abca1 T C 4: 53,042,376 R1899G probably damaging Het
Abca6 C T 11: 110,241,581 G296D probably damaging Het
Abcb5 A T 12: 118,890,549 probably null Het
Adam28 T G 14: 68,633,208 T339P probably damaging Het
Adcy10 C G 1: 165,518,374 Q331E probably damaging Het
Aldh1a2 A T 9: 71,252,914 probably null Het
Alms1 T A 6: 85,696,657 I3078N probably damaging Het
Amtn A T 5: 88,380,280 N71Y probably damaging Het
Arid4a T C 12: 71,075,088 S748P probably benign Het
Atp2b1 C A 10: 99,016,980 Q108K possibly damaging Het
Bcdin3d T C 15: 99,470,949 D123G probably benign Het
Capn15 A G 17: 25,965,436 S24P probably damaging Het
Cc2d2a T A 5: 43,739,412 S1550R possibly damaging Het
Ccdc7a C T 8: 128,832,610 V1174M probably damaging Het
Cd22 T A 7: 30,876,153 I155F probably damaging Het
Ceacam3 T C 7: 17,161,938 I611T possibly damaging Het
Chrna1 C T 2: 73,566,836 D370N possibly damaging Het
Diexf G T 1: 193,128,376 D106E probably benign Het
Dlg2 C A 7: 92,444,508 probably null Het
Dll4 A T 2: 119,333,795 probably null Het
Eif5b T C 1: 38,019,027 S137P probably benign Het
Epn2 A T 11: 61,533,641 M250K probably damaging Het
Fat2 T A 11: 55,270,457 Q3149L probably damaging Het
Fbxl13 G A 5: 21,556,814 S341F probably benign Het
Gm15922 T A 7: 3,738,931 Y150F probably benign Het
Gm5141 A T 13: 62,774,783 C191S probably damaging Het
Gm5150 C T 3: 15,990,651 G137S probably damaging Het
Gm5346 T A 8: 43,626,152 H345L probably damaging Het
Gpr75 C T 11: 30,891,529 R145W probably damaging Het
Heatr5b G A 17: 78,753,073 H2058Y probably benign Het
Ina G A 19: 47,023,561 E473K probably benign Het
Irx6 T C 8: 92,676,072 S22P probably benign Het
Itpr1 T A 6: 108,417,972 M32K probably damaging Het
Jmjd1c T A 10: 67,226,016 S1383T probably benign Het
Lclat1 T A 17: 73,161,833 S3T probably damaging Het
Llgl1 G A 11: 60,709,660 V612M probably damaging Het
Mios A G 6: 8,231,239 R708G probably benign Het
Mphosph8 T C 14: 56,688,486 L636P probably damaging Het
Mrgpra2b T A 7: 47,464,145 N254Y probably damaging Het
Myo7a C T 7: 98,073,167 V1184M probably benign Het
Myog G A 1: 134,290,488 D145N probably benign Het
Nat10 T A 2: 103,739,886 I371F possibly damaging Het
Neb A T 2: 52,167,644 Y229* probably null Het
Nlrp6 T A 7: 140,927,509 I896K possibly damaging Het
Olfr235 T C 19: 12,268,706 S159P probably damaging Het
Olfr551 G A 7: 102,588,671 A24V probably benign Het
Olfr740 A T 14: 50,453,585 I178L possibly damaging Het
Pcdhgc5 A C 18: 37,821,248 E525A probably damaging Het
Pkd2 C A 5: 104,459,924 D96E probably benign Het
Prtg A G 9: 72,907,856 D1022G probably damaging Het
Ptpn13 T C 5: 103,541,284 M981T probably benign Het
Rc3h2 C A 2: 37,409,470 A183S probably damaging Het
Rorb A T 19: 18,960,492 I270N probably damaging Het
Rpgrip1 C T 14: 52,141,189 R524W probably damaging Het
Slc25a10 T C 11: 120,495,205 V124A probably damaging Het
Slc40a1 T A 1: 45,918,947 I109F probably damaging Het
Spen G A 4: 141,475,509 R1936W probably damaging Het
St6gal2 T A 17: 55,482,513 Y183N probably benign Het
Svil A G 18: 5,056,629 K588E possibly damaging Het
Tas2r122 C T 6: 132,711,663 W89* probably null Het
Tbxas1 T A 6: 38,952,145 probably benign Het
Tia1 T A 6: 86,420,378 I111N probably damaging Het
Tlr9 T A 9: 106,223,999 L163H probably damaging Het
Tnn C T 1: 160,114,719 V806M probably damaging Het
Traf5 G A 1: 191,999,926 A318V probably benign Het
Ttc3 T A 16: 94,418,623 M1K probably null Het
Vmn1r192 T A 13: 22,187,830 R73S probably benign Het
Vmn1r71 T C 7: 10,748,404 Y53C probably benign Het
Vmn2r34 T A 7: 7,683,583 N372Y probably damaging Het
Wbp2 A T 11: 116,079,753 S229R probably damaging Het
Other mutations in Wdr18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01382:Wdr18 APN 10 79965272 missense probably damaging 1.00
IGL02812:Wdr18 APN 10 79961064 missense possibly damaging 0.68
IGL02949:Wdr18 APN 10 79965055 missense probably benign 0.00
R0066:Wdr18 UTSW 10 79961103 nonsense probably null
R0066:Wdr18 UTSW 10 79961103 nonsense probably null
R0244:Wdr18 UTSW 10 79966408 missense probably damaging 1.00
R0257:Wdr18 UTSW 10 79961119 splice site probably benign
R0377:Wdr18 UTSW 10 79967502 missense probably benign 0.40
R1844:Wdr18 UTSW 10 79966727 critical splice donor site probably null
R4179:Wdr18 UTSW 10 79965041 missense probably damaging 1.00
R4674:Wdr18 UTSW 10 79965235 missense probably benign
R5573:Wdr18 UTSW 10 79965038 missense probably benign
R6007:Wdr18 UTSW 10 79965343 missense possibly damaging 0.94
R7042:Wdr18 UTSW 10 79966110 missense probably benign 0.22
R7223:Wdr18 UTSW 10 79960368 missense probably damaging 1.00
R7316:Wdr18 UTSW 10 79965225 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCAATAGGCTGGTGACTACTG -3'
(R):5'- GGAATTTCCAGCAGACAGGC -3'

Sequencing Primer
(F):5'- GGTGACTACTGAGGTATCCCATTC -3'
(R):5'- GACAGTCCATCTCTGGGTGTC -3'
Posted On2018-05-24