Incidental Mutation 'R6501:Vav2'
ID519713
Institutional Source Beutler Lab
Gene Symbol Vav2
Ensembl Gene ENSMUSG00000009621
Gene Namevav 2 oncogene
Synonyms2810040F13Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.441) question?
Stock #R6501 (G1)
Quality Score154.008
Status Validated
Chromosome2
Chromosomal Location27262104-27427033 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 27296219 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 208 (L208P)
Ref Sequence ENSEMBL: ENSMUSP00000138964 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056176] [ENSMUST00000185188]
Predicted Effect probably damaging
Transcript: ENSMUST00000056176
AA Change: L242P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000062782
Gene: ENSMUSG00000009621
AA Change: L242P

DomainStartEndE-ValueType
CH 3 115 1.87e-24 SMART
low complexity region 165 176 N/A INTRINSIC
RhoGEF 197 370 2.41e-57 SMART
PH 401 504 2.05e-10 SMART
C1 514 562 1.43e-11 SMART
SH3 579 641 1.26e-13 SMART
SH2 661 743 3.37e-25 SMART
low complexity region 759 777 N/A INTRINSIC
SH3 809 866 3.27e-21 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000185188
AA Change: L208P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138964
Gene: ENSMUSG00000009621
AA Change: L208P

DomainStartEndE-ValueType
CH 3 129 3.71e-2 SMART
RhoGEF 163 336 2.41e-57 SMART
PH 367 475 1.78e-10 SMART
C1 485 533 1.43e-11 SMART
SH3 550 612 1.26e-13 SMART
SH2 632 714 1.26e-15 SMART
low complexity region 771 789 N/A INTRINSIC
Meta Mutation Damage Score 0.54 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: This gene encodes a member of the Vav family of Rho guanine nucleotide exchange factors. Vav family proteins are involved in the development and activation of lymphocytes, and the encoded protein may also be involved in angiogenesis. Disruption of this gene in mice is associated with heart, artery, and kidney defects, as well as tachycardia and hypertension. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous null mutants have defects in humoral immune response to type II thymus-independent antigens, in primary response to thymus-dependent antigens and inability to switch immunoglobulin class, form germinal centers and generate secondary responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd8 A T 8: 71,461,521 C154* probably null Het
Ada A G 2: 163,728,188 probably null Het
Birc6 G A 17: 74,579,281 V535I probably damaging Het
Bptf T C 11: 107,077,683 N1058S probably null Het
Cdadc1 C T 14: 59,586,449 C198Y probably benign Het
Chrna7 G A 7: 63,106,115 R228C probably damaging Het
Cts6 T C 13: 61,196,335 N301S probably damaging Het
Cts8 T A 13: 61,250,942 D250V probably damaging Het
Cyp26a1 G T 19: 37,699,070 R235L possibly damaging Het
Disc1 A T 8: 125,218,105 M598L probably benign Het
Ear6 T A 14: 51,854,224 V76D possibly damaging Het
Grifin A G 5: 140,563,281 *145R probably null Het
Htr2b T G 1: 86,110,641 E11A probably damaging Het
Krtap4-9 T A 11: 99,785,429 probably benign Het
Larp4b A C 13: 9,168,793 H522P probably damaging Het
Macf1 A T 4: 123,469,632 probably null Het
Mdfic T C 6: 15,770,517 L174P possibly damaging Het
Mmp17 A G 5: 129,606,405 E535G probably benign Het
Nfxl1 A T 5: 72,528,509 probably null Het
Nynrin A T 14: 55,863,532 T260S probably benign Het
Olfr1294 C T 2: 111,537,779 G170D probably damaging Het
Olfr859 A T 9: 19,808,975 Y219F possibly damaging Het
Olfr905 A T 9: 38,473,289 I181F possibly damaging Het
Pbx1 G T 1: 168,209,534 D109E probably damaging Het
Pde4d A T 13: 109,116,942 H101L probably benign Het
Pdlim3 T C 8: 45,908,602 I155T possibly damaging Het
Plekha5 T A 6: 140,525,929 Y26* probably null Het
Prpf6 T A 2: 181,621,920 L191* probably null Het
Rabl6 A G 2: 25,602,447 V80A possibly damaging Het
Rp1 T C 1: 4,311,280 probably benign Het
Sec14l1 A G 11: 117,156,850 S698G probably damaging Het
Skiv2l A G 17: 34,844,436 S622P possibly damaging Het
Slc19a1 G A 10: 77,049,606 G447S probably benign Het
Slc2a6 A T 2: 27,023,131 Y383* probably null Het
Slc9a9 C A 9: 94,936,371 Q273K probably benign Het
Spint2 A G 7: 29,263,706 Y56H probably damaging Het
Sspo T A 6: 48,495,212 M123K possibly damaging Het
Syne2 A G 12: 76,027,847 probably null Het
Trdn A C 10: 33,466,454 K619N probably benign Het
Ttll13 A G 7: 80,250,176 T119A possibly damaging Het
Ttn T C 2: 76,785,646 Y8324C probably damaging Het
Ttn T C 2: 76,898,258 probably benign Het
Vmn1r179 A G 7: 23,928,917 I178V probably benign Het
Vmn1r210 T C 13: 22,827,535 M194V possibly damaging Het
Vmn2r103 A T 17: 19,811,904 T647S probably benign Het
Wdr49 T A 3: 75,339,458 H289L probably benign Het
Wnk2 T G 13: 49,146,683 K184Q probably damaging Het
Zfp758 A G 17: 22,371,997 probably benign Het
Other mutations in Vav2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:Vav2 APN 2 27277238 missense probably benign 0.35
IGL02394:Vav2 APN 2 27297659 splice site probably benign
IGL03088:Vav2 APN 2 27267250 missense possibly damaging 0.74
IGL03256:Vav2 APN 2 27271900 splice site probably null
IGL03295:Vav2 APN 2 27275029 missense possibly damaging 0.90
R0097:Vav2 UTSW 2 27299362 splice site probably benign
R0097:Vav2 UTSW 2 27299362 splice site probably benign
R0140:Vav2 UTSW 2 27273676 splice site probably benign
R0331:Vav2 UTSW 2 27296175 missense probably benign 0.09
R0619:Vav2 UTSW 2 27296121 critical splice donor site probably null
R1191:Vav2 UTSW 2 27292780 splice site probably null
R1723:Vav2 UTSW 2 27318964 missense possibly damaging 0.94
R2107:Vav2 UTSW 2 27267303 missense probably damaging 1.00
R2131:Vav2 UTSW 2 27299396 missense possibly damaging 0.71
R2164:Vav2 UTSW 2 27273706 missense probably damaging 0.96
R2268:Vav2 UTSW 2 27292655 splice site probably null
R2927:Vav2 UTSW 2 27426391 missense probably damaging 1.00
R3802:Vav2 UTSW 2 27267223 splice site probably benign
R4050:Vav2 UTSW 2 27288679 missense probably benign 0.01
R4050:Vav2 UTSW 2 27291403 missense probably damaging 1.00
R4626:Vav2 UTSW 2 27270160 missense possibly damaging 0.62
R4895:Vav2 UTSW 2 27318961 missense probably damaging 0.99
R5441:Vav2 UTSW 2 27270110 intron probably benign
R6009:Vav2 UTSW 2 27271900 splice site probably null
R6564:Vav2 UTSW 2 27279185 splice site probably null
R7206:Vav2 UTSW 2 27336719 missense probably benign 0.17
R7267:Vav2 UTSW 2 27283322 missense probably damaging 0.99
R7541:Vav2 UTSW 2 27275002 missense not run
X0064:Vav2 UTSW 2 27282351 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCAGTCCCGAGAATGTGAG -3'
(R):5'- CCTGCTAGAAGCTTCTGACTGAG -3'

Sequencing Primer
(F):5'- CATCATGCACGGGCTGGTTTC -3'
(R):5'- AGCTTCTGACTGAGTGATAGTAGAC -3'
Posted On2018-06-06