Incidental Mutation 'R6501:Mdfic'
ID519722
Institutional Source Beutler Lab
Gene Symbol Mdfic
Ensembl Gene ENSMUSG00000041390
Gene NameMyoD family inhibitor domain containing
Synonymsclone 1.5, Kdt1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.321) question?
Stock #R6501 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location15720661-15802169 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 15770517 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 174 (L174P)
Ref Sequence ENSEMBL: ENSMUSP00000139704 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101663] [ENSMUST00000120512] [ENSMUST00000125326] [ENSMUST00000128849] [ENSMUST00000140516] [ENSMUST00000189359] [ENSMUST00000190255]
Predicted Effect probably benign
Transcript: ENSMUST00000101663
SMART Domains Protein: ENSMUSP00000099186
Gene: ENSMUSG00000041390

DomainStartEndE-ValueType
Pfam:MDFI 74 247 7.3e-74 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120512
SMART Domains Protein: ENSMUSP00000113050
Gene: ENSMUSG00000041390

DomainStartEndE-ValueType
Pfam:MDFI 74 247 1.6e-76 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000125326
AA Change: L174P

PolyPhen 2 Score 0.479 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000139704
Gene: ENSMUSG00000041390
AA Change: L174P

DomainStartEndE-ValueType
Pfam:MDFI 74 175 6e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128849
Predicted Effect probably benign
Transcript: ENSMUST00000140516
Predicted Effect probably benign
Transcript: ENSMUST00000189359
SMART Domains Protein: ENSMUSP00000140208
Gene: ENSMUSG00000041390

DomainStartEndE-ValueType
Pfam:MDFI 74 247 1.6e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000190255
SMART Domains Protein: ENSMUSP00000140641
Gene: ENSMUSG00000041390

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
Pfam:MDFI 156 329 8.8e-73 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: This gene product is a member of a family of proteins characterized by a specific cysteine-rich C-terminal domain, which is involved in transcriptional regulation of viral genome expression. Alternative translation initiation from an upstream non-AUG (GUG), and an in-frame, downstream AUG codon, results in the production of two isoforms, which in human have been shown to have different subcellular localization. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd8 A T 8: 71,461,521 C154* probably null Het
Ada A G 2: 163,728,188 probably null Het
Birc6 G A 17: 74,579,281 V535I probably damaging Het
Bptf T C 11: 107,077,683 N1058S probably null Het
Cdadc1 C T 14: 59,586,449 C198Y probably benign Het
Chrna7 G A 7: 63,106,115 R228C probably damaging Het
Cts6 T C 13: 61,196,335 N301S probably damaging Het
Cts8 T A 13: 61,250,942 D250V probably damaging Het
Cyp26a1 G T 19: 37,699,070 R235L possibly damaging Het
Disc1 A T 8: 125,218,105 M598L probably benign Het
Ear6 T A 14: 51,854,224 V76D possibly damaging Het
Grifin A G 5: 140,563,281 *145R probably null Het
Htr2b T G 1: 86,110,641 E11A probably damaging Het
Krtap4-9 T A 11: 99,785,429 probably benign Het
Larp4b A C 13: 9,168,793 H522P probably damaging Het
Macf1 A T 4: 123,469,632 probably null Het
Mmp17 A G 5: 129,606,405 E535G probably benign Het
Nfxl1 A T 5: 72,528,509 probably null Het
Nynrin A T 14: 55,863,532 T260S probably benign Het
Olfr1294 C T 2: 111,537,779 G170D probably damaging Het
Olfr859 A T 9: 19,808,975 Y219F possibly damaging Het
Olfr905 A T 9: 38,473,289 I181F possibly damaging Het
Pbx1 G T 1: 168,209,534 D109E probably damaging Het
Pde4d A T 13: 109,116,942 H101L probably benign Het
Pdlim3 T C 8: 45,908,602 I155T possibly damaging Het
Plekha5 T A 6: 140,525,929 Y26* probably null Het
Prpf6 T A 2: 181,621,920 L191* probably null Het
Rabl6 A G 2: 25,602,447 V80A possibly damaging Het
Rp1 T C 1: 4,311,280 probably benign Het
Sec14l1 A G 11: 117,156,850 S698G probably damaging Het
Skiv2l A G 17: 34,844,436 S622P possibly damaging Het
Slc19a1 G A 10: 77,049,606 G447S probably benign Het
Slc2a6 A T 2: 27,023,131 Y383* probably null Het
Slc9a9 C A 9: 94,936,371 Q273K probably benign Het
Spint2 A G 7: 29,263,706 Y56H probably damaging Het
Sspo T A 6: 48,495,212 M123K possibly damaging Het
Syne2 A G 12: 76,027,847 probably null Het
Trdn A C 10: 33,466,454 K619N probably benign Het
Ttll13 A G 7: 80,250,176 T119A possibly damaging Het
Ttn T C 2: 76,785,646 Y8324C probably damaging Het
Ttn T C 2: 76,898,258 probably benign Het
Vav2 A G 2: 27,296,219 L208P probably damaging Het
Vmn1r179 A G 7: 23,928,917 I178V probably benign Het
Vmn1r210 T C 13: 22,827,535 M194V possibly damaging Het
Vmn2r103 A T 17: 19,811,904 T647S probably benign Het
Wdr49 T A 3: 75,339,458 H289L probably benign Het
Wnk2 T G 13: 49,146,683 K184Q probably damaging Het
Zfp758 A G 17: 22,371,997 probably benign Het
Other mutations in Mdfic
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00579:Mdfic APN 6 15741074 missense possibly damaging 0.95
IGL02184:Mdfic APN 6 15770367 missense possibly damaging 0.76
IGL03104:Mdfic APN 6 15770320 missense probably damaging 1.00
IGL03177:Mdfic APN 6 15770451 missense probably damaging 1.00
R0521:Mdfic UTSW 6 15799756 missense probably benign 0.07
R1549:Mdfic UTSW 6 15799845 missense probably damaging 1.00
R1613:Mdfic UTSW 6 15799590 intron probably null
R2496:Mdfic UTSW 6 15741042 missense possibly damaging 0.92
R3087:Mdfic UTSW 6 15799669 missense probably damaging 1.00
R3623:Mdfic UTSW 6 15770320 missense probably damaging 1.00
R3887:Mdfic UTSW 6 15799711 missense probably damaging 1.00
R4736:Mdfic UTSW 6 15741020 missense possibly damaging 0.79
R5704:Mdfic UTSW 6 15770292 missense probably damaging 1.00
R6187:Mdfic UTSW 6 15721197 utr 5 prime probably benign
R6517:Mdfic UTSW 6 15770325 missense probably damaging 1.00
R6521:Mdfic UTSW 6 15729028 intron probably benign
Predicted Primers PCR Primer
(F):5'- TGTCCGTGGAGAATCACAAG -3'
(R):5'- ATAGAGGCACTGTGATACGCC -3'

Sequencing Primer
(F):5'- TGTCCGTGGAGAATCACAAGATATC -3'
(R):5'- TGTGATACGCCCCCAAATGG -3'
Posted On2018-06-06