Incidental Mutation 'R6501:Chrna7'
ID519727
Institutional Source Beutler Lab
Gene Symbol Chrna7
Ensembl Gene ENSMUSG00000030525
Gene Namecholinergic receptor, nicotinic, alpha polypeptide 7
Synonymsalpha7-nAChR, alpha7, Acra7, alpha7 nicotinic receptor
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6501 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location63098692-63212569 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 63106115 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 228 (R228C)
Ref Sequence ENSEMBL: ENSMUSP00000032738 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032738]
Predicted Effect probably damaging
Transcript: ENSMUST00000032738
AA Change: R228C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032738
Gene: ENSMUSG00000030525
AA Change: R228C

DomainStartEndE-ValueType
low complexity region 10 17 N/A INTRINSIC
Pfam:Neur_chan_LBD 26 230 1e-75 PFAM
Pfam:Neur_chan_memb 237 487 3.6e-63 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nicotinic acetylcholine receptors (nAChRs) are members of a superfamily of ligand-gated ion channels that mediate fast signal transmission at synapses. The nAChRs are thought to be hetero-pentamers composed of homologous subunits. The proposed structure for each subunit is a conserved N-terminal extracellular domain followed by three conserved transmembrane domains, a variable cytoplasmic loop, a fourth conserved transmembrane domain, and a short C-terminal extracellular region. The protein encoded by this gene forms a homo-oligomeric channel, displays marked permeability to calcium ions and is a major component of brain nicotinic receptors that are blocked by, and highly sensitive to, alpha-bungarotoxin. Once this receptor binds acetylcholine, it undergoes an extensive change in conformation that affects all subunits and leads to opening of an ion-conducting channel across the plasma membrane. This gene is located in a region identified as a major susceptibility locus for juvenile myoclonic epilepsy and a chromosomal location involved in the genetic transmission of schizophrenia. An evolutionarily recent partial duplication event in this region results in a hybrid containing sequence from this gene and a novel FAM7A gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2012]
PHENOTYPE: Nullizygous mice lack hippocampal fast nicotinic currents but show nicotine-induced seizures as well as altered anxiety behavior, fertility defects, airway basal cell hyperplasia. and higher TNF sythesis when endotoxemic. Newborns homozygous for a knock-in allele die with increased neuron apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd8 A T 8: 71,461,521 C154* probably null Het
Ada A G 2: 163,728,188 probably null Het
Birc6 G A 17: 74,579,281 V535I probably damaging Het
Bptf T C 11: 107,077,683 N1058S probably null Het
Cdadc1 C T 14: 59,586,449 C198Y probably benign Het
Cts6 T C 13: 61,196,335 N301S probably damaging Het
Cts8 T A 13: 61,250,942 D250V probably damaging Het
Cyp26a1 G T 19: 37,699,070 R235L possibly damaging Het
Disc1 A T 8: 125,218,105 M598L probably benign Het
Ear6 T A 14: 51,854,224 V76D possibly damaging Het
Grifin A G 5: 140,563,281 *145R probably null Het
Htr2b T G 1: 86,110,641 E11A probably damaging Het
Krtap4-9 T A 11: 99,785,429 probably benign Het
Larp4b A C 13: 9,168,793 H522P probably damaging Het
Macf1 A T 4: 123,469,632 probably null Het
Mdfic T C 6: 15,770,517 L174P possibly damaging Het
Mmp17 A G 5: 129,606,405 E535G probably benign Het
Nfxl1 A T 5: 72,528,509 probably null Het
Nynrin A T 14: 55,863,532 T260S probably benign Het
Olfr1294 C T 2: 111,537,779 G170D probably damaging Het
Olfr859 A T 9: 19,808,975 Y219F possibly damaging Het
Olfr905 A T 9: 38,473,289 I181F possibly damaging Het
Pbx1 G T 1: 168,209,534 D109E probably damaging Het
Pde4d A T 13: 109,116,942 H101L probably benign Het
Pdlim3 T C 8: 45,908,602 I155T possibly damaging Het
Plekha5 T A 6: 140,525,929 Y26* probably null Het
Prpf6 T A 2: 181,621,920 L191* probably null Het
Rabl6 A G 2: 25,602,447 V80A possibly damaging Het
Rp1 T C 1: 4,311,280 probably benign Het
Sec14l1 A G 11: 117,156,850 S698G probably damaging Het
Skiv2l A G 17: 34,844,436 S622P possibly damaging Het
Slc19a1 G A 10: 77,049,606 G447S probably benign Het
Slc2a6 A T 2: 27,023,131 Y383* probably null Het
Slc9a9 C A 9: 94,936,371 Q273K probably benign Het
Spint2 A G 7: 29,263,706 Y56H probably damaging Het
Sspo T A 6: 48,495,212 M123K possibly damaging Het
Syne2 A G 12: 76,027,847 probably null Het
Trdn A C 10: 33,466,454 K619N probably benign Het
Ttll13 A G 7: 80,250,176 T119A possibly damaging Het
Ttn T C 2: 76,785,646 Y8324C probably damaging Het
Ttn T C 2: 76,898,258 probably benign Het
Vav2 A G 2: 27,296,219 L208P probably damaging Het
Vmn1r179 A G 7: 23,928,917 I178V probably benign Het
Vmn1r210 T C 13: 22,827,535 M194V possibly damaging Het
Vmn2r103 A T 17: 19,811,904 T647S probably benign Het
Wdr49 T A 3: 75,339,458 H289L probably benign Het
Wnk2 T G 13: 49,146,683 K184Q probably damaging Het
Zfp758 A G 17: 22,371,997 probably benign Het
Other mutations in Chrna7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01776:Chrna7 APN 7 63099519 missense probably benign 0.01
IGL01999:Chrna7 APN 7 63103791 missense probably damaging 1.00
IGL02016:Chrna7 APN 7 63103835 missense probably damaging 1.00
IGL02388:Chrna7 APN 7 63107691 missense probably damaging 1.00
IGL02400:Chrna7 APN 7 63099322 missense probably damaging 1.00
IGL02458:Chrna7 APN 7 63106094 missense probably damaging 1.00
IGL03039:Chrna7 APN 7 63148592 missense probably damaging 1.00
inflation UTSW 7 63148601 missense probably damaging 1.00
R0034:Chrna7 UTSW 7 63148606 missense possibly damaging 0.79
R0631:Chrna7 UTSW 7 63099643 missense probably benign 0.00
R1666:Chrna7 UTSW 7 63212142 missense possibly damaging 0.70
R1703:Chrna7 UTSW 7 63099507 missense probably damaging 0.99
R1763:Chrna7 UTSW 7 63099252 missense probably benign 0.05
R1974:Chrna7 UTSW 7 63099286 missense probably damaging 1.00
R2294:Chrna7 UTSW 7 63110424 missense probably benign 0.11
R2393:Chrna7 UTSW 7 63099246 missense probably damaging 1.00
R4598:Chrna7 UTSW 7 63103790 missense probably damaging 1.00
R4599:Chrna7 UTSW 7 63103790 missense probably damaging 1.00
R4842:Chrna7 UTSW 7 63212448 missense probably benign 0.05
R5143:Chrna7 UTSW 7 63106147 missense probably damaging 1.00
R5310:Chrna7 UTSW 7 63106057 missense probably damaging 1.00
R5339:Chrna7 UTSW 7 63099307 missense probably damaging 1.00
R5516:Chrna7 UTSW 7 63099298 missense probably damaging 0.98
R5807:Chrna7 UTSW 7 63148601 missense probably damaging 1.00
R6918:Chrna7 UTSW 7 63159551 missense probably benign 0.03
R7000:Chrna7 UTSW 7 63106039 missense probably damaging 1.00
R7189:Chrna7 UTSW 7 63106027 missense probably damaging 1.00
R7483:Chrna7 UTSW 7 63104990 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCGTAGGTCACAAGGAACTCC -3'
(R):5'- GCTCCTGTGTACTATATACTTGGG -3'

Sequencing Primer
(F):5'- TAGGTCACAAGGAACTCCTGCATG -3'
(R):5'- TCTGATGACCTGATGTCC -3'
Posted On2018-06-06