Incidental Mutation 'R6501:Chrna7'
ID 519727
Institutional Source Beutler Lab
Gene Symbol Chrna7
Ensembl Gene ENSMUSG00000030525
Gene Name cholinergic receptor, nicotinic, alpha polypeptide 7
Synonyms alpha7 nicotinic receptor, alpha7, alpha7-nAChR, Acra7
MMRRC Submission 044633-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6501 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 62748440-62862274 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 62755863 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 228 (R228C)
Ref Sequence ENSEMBL: ENSMUSP00000032738 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032738]
AlphaFold P49582
Predicted Effect probably damaging
Transcript: ENSMUST00000032738
AA Change: R228C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032738
Gene: ENSMUSG00000030525
AA Change: R228C

DomainStartEndE-ValueType
low complexity region 10 17 N/A INTRINSIC
Pfam:Neur_chan_LBD 26 230 1e-75 PFAM
Pfam:Neur_chan_memb 237 487 3.6e-63 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nicotinic acetylcholine receptors (nAChRs) are members of a superfamily of ligand-gated ion channels that mediate fast signal transmission at synapses. The nAChRs are thought to be hetero-pentamers composed of homologous subunits. The proposed structure for each subunit is a conserved N-terminal extracellular domain followed by three conserved transmembrane domains, a variable cytoplasmic loop, a fourth conserved transmembrane domain, and a short C-terminal extracellular region. The protein encoded by this gene forms a homo-oligomeric channel, displays marked permeability to calcium ions and is a major component of brain nicotinic receptors that are blocked by, and highly sensitive to, alpha-bungarotoxin. Once this receptor binds acetylcholine, it undergoes an extensive change in conformation that affects all subunits and leads to opening of an ion-conducting channel across the plasma membrane. This gene is located in a region identified as a major susceptibility locus for juvenile myoclonic epilepsy and a chromosomal location involved in the genetic transmission of schizophrenia. An evolutionarily recent partial duplication event in this region results in a hybrid containing sequence from this gene and a novel FAM7A gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2012]
PHENOTYPE: Nullizygous mice lack hippocampal fast nicotinic currents but show nicotine-induced seizures as well as altered anxiety behavior, fertility defects, airway basal cell hyperplasia. and higher TNF sythesis when endotoxemic. Newborns homozygous for a knock-in allele die with increased neuron apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd8 A T 8: 71,914,165 (GRCm39) C154* probably null Het
Ada A G 2: 163,570,108 (GRCm39) probably null Het
Birc6 G A 17: 74,886,276 (GRCm39) V535I probably damaging Het
Bptf T C 11: 106,968,509 (GRCm39) N1058S probably null Het
Cdadc1 C T 14: 59,823,898 (GRCm39) C198Y probably benign Het
Cts6 T C 13: 61,344,149 (GRCm39) N301S probably damaging Het
Cts8 T A 13: 61,398,756 (GRCm39) D250V probably damaging Het
Cyp26a1 G T 19: 37,687,518 (GRCm39) R235L possibly damaging Het
Disc1 A T 8: 125,944,844 (GRCm39) M598L probably benign Het
Ear6 T A 14: 52,091,681 (GRCm39) V76D possibly damaging Het
Grifin A G 5: 140,549,036 (GRCm39) *145R probably null Het
Htr2b T G 1: 86,038,363 (GRCm39) E11A probably damaging Het
Krtap4-9 T A 11: 99,676,255 (GRCm39) probably benign Het
Larp4b A C 13: 9,218,829 (GRCm39) H522P probably damaging Het
Macf1 A T 4: 123,363,425 (GRCm39) probably null Het
Mdfic T C 6: 15,770,516 (GRCm39) L174P possibly damaging Het
Mmp17 A G 5: 129,683,469 (GRCm39) E535G probably benign Het
Nfxl1 A T 5: 72,685,852 (GRCm39) probably null Het
Nynrin A T 14: 56,100,989 (GRCm39) T260S probably benign Het
Or4k44 C T 2: 111,368,124 (GRCm39) G170D probably damaging Het
Or7e168 A T 9: 19,720,271 (GRCm39) Y219F possibly damaging Het
Or8b1c A T 9: 38,384,585 (GRCm39) I181F possibly damaging Het
Pbx1 G T 1: 168,037,103 (GRCm39) D109E probably damaging Het
Pde4d A T 13: 109,253,476 (GRCm39) H101L probably benign Het
Pdlim3 T C 8: 46,361,639 (GRCm39) I155T possibly damaging Het
Plekha5 T A 6: 140,471,655 (GRCm39) Y26* probably null Het
Prpf6 T A 2: 181,263,713 (GRCm39) L191* probably null Het
Rabl6 A G 2: 25,492,459 (GRCm39) V80A possibly damaging Het
Rp1 T C 1: 4,381,503 (GRCm39) probably benign Het
Sec14l1 A G 11: 117,047,676 (GRCm39) S698G probably damaging Het
Skic2 A G 17: 35,063,412 (GRCm39) S622P possibly damaging Het
Slc19a1 G A 10: 76,885,440 (GRCm39) G447S probably benign Het
Slc2a6 A T 2: 26,913,143 (GRCm39) Y383* probably null Het
Slc9a9 C A 9: 94,818,424 (GRCm39) Q273K probably benign Het
Spint2 A G 7: 28,963,131 (GRCm39) Y56H probably damaging Het
Sspo T A 6: 48,472,146 (GRCm39) M123K possibly damaging Het
Syne2 A G 12: 76,074,621 (GRCm39) probably null Het
Trdn A C 10: 33,342,450 (GRCm39) K619N probably benign Het
Ttll13 A G 7: 79,899,924 (GRCm39) T119A possibly damaging Het
Ttn T C 2: 76,615,990 (GRCm39) Y8324C probably damaging Het
Ttn T C 2: 76,728,602 (GRCm39) probably benign Het
Vav2 A G 2: 27,186,231 (GRCm39) L208P probably damaging Het
Vmn1r179 A G 7: 23,628,342 (GRCm39) I178V probably benign Het
Vmn1r210 T C 13: 23,011,705 (GRCm39) M194V possibly damaging Het
Vmn2r103 A T 17: 20,032,166 (GRCm39) T647S probably benign Het
Wdr49 T A 3: 75,246,765 (GRCm39) H289L probably benign Het
Wnk2 T G 13: 49,300,159 (GRCm39) K184Q probably damaging Het
Zfp758 A G 17: 22,590,978 (GRCm39) probably benign Het
Other mutations in Chrna7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01776:Chrna7 APN 7 62,749,267 (GRCm39) missense probably benign 0.01
IGL01999:Chrna7 APN 7 62,753,539 (GRCm39) missense probably damaging 1.00
IGL02016:Chrna7 APN 7 62,753,583 (GRCm39) missense probably damaging 1.00
IGL02388:Chrna7 APN 7 62,757,439 (GRCm39) missense probably damaging 1.00
IGL02400:Chrna7 APN 7 62,749,070 (GRCm39) missense probably damaging 1.00
IGL02458:Chrna7 APN 7 62,755,842 (GRCm39) missense probably damaging 1.00
IGL03039:Chrna7 APN 7 62,798,340 (GRCm39) missense probably damaging 1.00
inflation UTSW 7 62,798,349 (GRCm39) missense probably damaging 1.00
thaler UTSW 7 62,755,775 (GRCm39) missense probably damaging 1.00
R0034:Chrna7 UTSW 7 62,798,354 (GRCm39) missense possibly damaging 0.79
R0631:Chrna7 UTSW 7 62,749,391 (GRCm39) missense probably benign 0.00
R1666:Chrna7 UTSW 7 62,861,890 (GRCm39) missense possibly damaging 0.70
R1703:Chrna7 UTSW 7 62,749,255 (GRCm39) missense probably damaging 0.99
R1763:Chrna7 UTSW 7 62,749,000 (GRCm39) missense probably benign 0.05
R1974:Chrna7 UTSW 7 62,749,034 (GRCm39) missense probably damaging 1.00
R2294:Chrna7 UTSW 7 62,760,172 (GRCm39) missense probably benign 0.11
R2393:Chrna7 UTSW 7 62,748,994 (GRCm39) missense probably damaging 1.00
R4598:Chrna7 UTSW 7 62,753,538 (GRCm39) missense probably damaging 1.00
R4599:Chrna7 UTSW 7 62,753,538 (GRCm39) missense probably damaging 1.00
R4842:Chrna7 UTSW 7 62,862,196 (GRCm39) missense probably benign 0.05
R5143:Chrna7 UTSW 7 62,755,895 (GRCm39) missense probably damaging 1.00
R5310:Chrna7 UTSW 7 62,755,805 (GRCm39) missense probably damaging 1.00
R5339:Chrna7 UTSW 7 62,749,055 (GRCm39) missense probably damaging 1.00
R5516:Chrna7 UTSW 7 62,749,046 (GRCm39) missense probably damaging 0.98
R5807:Chrna7 UTSW 7 62,798,349 (GRCm39) missense probably damaging 1.00
R6918:Chrna7 UTSW 7 62,809,299 (GRCm39) missense probably benign 0.03
R7000:Chrna7 UTSW 7 62,755,787 (GRCm39) missense probably damaging 1.00
R7189:Chrna7 UTSW 7 62,755,775 (GRCm39) missense probably damaging 1.00
R7483:Chrna7 UTSW 7 62,754,738 (GRCm39) missense probably damaging 1.00
R7953:Chrna7 UTSW 7 62,753,541 (GRCm39) missense possibly damaging 0.82
R7955:Chrna7 UTSW 7 62,753,541 (GRCm39) missense possibly damaging 0.82
R7956:Chrna7 UTSW 7 62,753,541 (GRCm39) missense possibly damaging 0.82
R8235:Chrna7 UTSW 7 62,861,972 (GRCm39) missense probably damaging 1.00
R9125:Chrna7 UTSW 7 62,757,357 (GRCm39) nonsense probably null
R9356:Chrna7 UTSW 7 62,757,437 (GRCm39) missense probably damaging 1.00
R9694:Chrna7 UTSW 7 62,754,809 (GRCm39) missense probably damaging 1.00
Z1176:Chrna7 UTSW 7 62,861,932 (GRCm39) missense probably damaging 1.00
Z1177:Chrna7 UTSW 7 62,757,299 (GRCm39) critical splice donor site probably null
Z1191:Chrna7 UTSW 7 62,755,941 (GRCm39) missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- ATCGTAGGTCACAAGGAACTCC -3'
(R):5'- GCTCCTGTGTACTATATACTTGGG -3'

Sequencing Primer
(F):5'- TAGGTCACAAGGAACTCCTGCATG -3'
(R):5'- TCTGATGACCTGATGTCC -3'
Posted On 2018-06-06