Incidental Mutation 'R6501:Slc19a1'
ID519736
Institutional Source Beutler Lab
Gene Symbol Slc19a1
Ensembl Gene ENSMUSG00000001436
Gene Namesolute carrier family 19 (folate transporter), member 1
SynonymsRFC1, RFC-1, reduced folate carrier
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6501 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location77032241-77061002 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 77049606 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 447 (G447S)
Ref Sequence ENSEMBL: ENSMUSP00000116784 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072755] [ENSMUST00000081654] [ENSMUST00000105409] [ENSMUST00000105410] [ENSMUST00000136925] [ENSMUST00000144234]
Predicted Effect probably benign
Transcript: ENSMUST00000072755
SMART Domains Protein: ENSMUSP00000072538
Gene: ENSMUSG00000001435

DomainStartEndE-ValueType
Pfam:DUF959 16 218 6.8e-104 PFAM
low complexity region 295 307 N/A INTRINSIC
FRI 369 484 4.03e-47 SMART
TSPN 492 680 4.25e-72 SMART
LamG 541 679 2.17e-2 SMART
low complexity region 699 715 N/A INTRINSIC
low complexity region 719 734 N/A INTRINSIC
low complexity region 739 751 N/A INTRINSIC
Pfam:Collagen 820 881 5.5e-11 PFAM
low complexity region 921 942 N/A INTRINSIC
Pfam:Collagen 951 1008 6.1e-10 PFAM
Pfam:Collagen 988 1053 1.4e-8 PFAM
Pfam:Collagen 1060 1117 7.3e-10 PFAM
low complexity region 1132 1147 N/A INTRINSIC
low complexity region 1166 1181 N/A INTRINSIC
low complexity region 1186 1202 N/A INTRINSIC
Pfam:Collagen 1207 1267 8.2e-10 PFAM
low complexity region 1275 1288 N/A INTRINSIC
low complexity region 1301 1319 N/A INTRINSIC
low complexity region 1358 1393 N/A INTRINSIC
low complexity region 1397 1414 N/A INTRINSIC
low complexity region 1417 1433 N/A INTRINSIC
low complexity region 1441 1454 N/A INTRINSIC
Pfam:Endostatin 1461 1769 4.4e-116 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000081654
SMART Domains Protein: ENSMUSP00000080358
Gene: ENSMUSG00000001435

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
TSPN 33 221 4.25e-72 SMART
LamG 82 220 2.17e-2 SMART
low complexity region 240 256 N/A INTRINSIC
low complexity region 260 275 N/A INTRINSIC
low complexity region 280 292 N/A INTRINSIC
Pfam:Collagen 359 422 1.6e-10 PFAM
low complexity region 462 483 N/A INTRINSIC
Pfam:Collagen 492 549 1.6e-9 PFAM
Pfam:Collagen 529 594 3.3e-8 PFAM
Pfam:Collagen 601 658 1.9e-9 PFAM
Pfam:Collagen 631 689 4e-8 PFAM
Pfam:Collagen 701 752 1.7e-7 PFAM
Pfam:Collagen 748 808 2.2e-9 PFAM
low complexity region 816 829 N/A INTRINSIC
low complexity region 842 860 N/A INTRINSIC
low complexity region 899 934 N/A INTRINSIC
low complexity region 938 955 N/A INTRINSIC
low complexity region 958 974 N/A INTRINSIC
low complexity region 982 995 N/A INTRINSIC
Pfam:Endostatin 999 1315 8.2e-151 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105409
SMART Domains Protein: ENSMUSP00000101049
Gene: ENSMUSG00000001435

DomainStartEndE-ValueType
Pfam:DUF959 16 219 3.6e-100 PFAM
TSPN 245 433 4.25e-72 SMART
LamG 294 432 2.17e-2 SMART
low complexity region 452 468 N/A INTRINSIC
low complexity region 472 487 N/A INTRINSIC
low complexity region 492 504 N/A INTRINSIC
low complexity region 542 613 N/A INTRINSIC
low complexity region 630 648 N/A INTRINSIC
low complexity region 674 695 N/A INTRINSIC
Pfam:Collagen 700 761 5.4e-9 PFAM
Pfam:Collagen 741 806 4e-8 PFAM
Pfam:Collagen 813 874 2.1e-10 PFAM
Pfam:Collagen 846 901 1.2e-7 PFAM
Pfam:Collagen 913 964 2.1e-7 PFAM
Pfam:Collagen 960 1020 2.6e-9 PFAM
low complexity region 1028 1041 N/A INTRINSIC
low complexity region 1054 1072 N/A INTRINSIC
low complexity region 1111 1146 N/A INTRINSIC
low complexity region 1150 1167 N/A INTRINSIC
low complexity region 1170 1186 N/A INTRINSIC
low complexity region 1194 1207 N/A INTRINSIC
Pfam:Endostatin 1211 1527 1.1e-150 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105410
AA Change: G447S

PolyPhen 2 Score 0.107 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000101050
Gene: ENSMUSG00000001436
AA Change: G447S

DomainStartEndE-ValueType
Pfam:Folate_carrier 23 427 3e-167 PFAM
Pfam:MFS_1 66 406 2.6e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127249
Predicted Effect probably benign
Transcript: ENSMUST00000131031
SMART Domains Protein: ENSMUSP00000114884
Gene: ENSMUSG00000001436

DomainStartEndE-ValueType
Pfam:Folate_carrier 1 112 1.3e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136925
SMART Domains Protein: ENSMUSP00000119382
Gene: ENSMUSG00000001436

DomainStartEndE-ValueType
Pfam:Folate_carrier 23 426 7.8e-163 PFAM
Pfam:MFS_1 66 405 4.4e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144234
AA Change: G447S

PolyPhen 2 Score 0.107 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000116784
Gene: ENSMUSG00000001436
AA Change: G447S

DomainStartEndE-ValueType
Pfam:Folate_carrier 23 427 3e-167 PFAM
Pfam:MFS_1 66 406 2.6e-13 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane protein encoded by this gene is a transporter of folate and is involved in the regulation of intracellular concentrations of folate. Three transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Mar 2011]
PHENOTYPE: Homozygous null embryos die due to abnormalities of hematopoietic organs. Mutant mice may be partially rescued with maternal folic acid supplementation, but these mice still present with hematopoietic organ defects and show impaired development of urogenital structures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd8 A T 8: 71,461,521 C154* probably null Het
Ada A G 2: 163,728,188 probably null Het
Birc6 G A 17: 74,579,281 V535I probably damaging Het
Bptf T C 11: 107,077,683 N1058S probably null Het
Cdadc1 C T 14: 59,586,449 C198Y probably benign Het
Chrna7 G A 7: 63,106,115 R228C probably damaging Het
Cts6 T C 13: 61,196,335 N301S probably damaging Het
Cts8 T A 13: 61,250,942 D250V probably damaging Het
Cyp26a1 G T 19: 37,699,070 R235L possibly damaging Het
Disc1 A T 8: 125,218,105 M598L probably benign Het
Ear6 T A 14: 51,854,224 V76D possibly damaging Het
Grifin A G 5: 140,563,281 *145R probably null Het
Htr2b T G 1: 86,110,641 E11A probably damaging Het
Krtap4-9 T A 11: 99,785,429 probably benign Het
Larp4b A C 13: 9,168,793 H522P probably damaging Het
Macf1 A T 4: 123,469,632 probably null Het
Mdfic T C 6: 15,770,517 L174P possibly damaging Het
Mmp17 A G 5: 129,606,405 E535G probably benign Het
Nfxl1 A T 5: 72,528,509 probably null Het
Nynrin A T 14: 55,863,532 T260S probably benign Het
Olfr1294 C T 2: 111,537,779 G170D probably damaging Het
Olfr859 A T 9: 19,808,975 Y219F possibly damaging Het
Olfr905 A T 9: 38,473,289 I181F possibly damaging Het
Pbx1 G T 1: 168,209,534 D109E probably damaging Het
Pde4d A T 13: 109,116,942 H101L probably benign Het
Pdlim3 T C 8: 45,908,602 I155T possibly damaging Het
Plekha5 T A 6: 140,525,929 Y26* probably null Het
Prpf6 T A 2: 181,621,920 L191* probably null Het
Rabl6 A G 2: 25,602,447 V80A possibly damaging Het
Rp1 T C 1: 4,311,280 probably benign Het
Sec14l1 A G 11: 117,156,850 S698G probably damaging Het
Skiv2l A G 17: 34,844,436 S622P possibly damaging Het
Slc2a6 A T 2: 27,023,131 Y383* probably null Het
Slc9a9 C A 9: 94,936,371 Q273K probably benign Het
Spint2 A G 7: 29,263,706 Y56H probably damaging Het
Sspo T A 6: 48,495,212 M123K possibly damaging Het
Syne2 A G 12: 76,027,847 probably null Het
Trdn A C 10: 33,466,454 K619N probably benign Het
Ttll13 A G 7: 80,250,176 T119A possibly damaging Het
Ttn T C 2: 76,785,646 Y8324C probably damaging Het
Ttn T C 2: 76,898,258 probably benign Het
Vav2 A G 2: 27,296,219 L208P probably damaging Het
Vmn1r179 A G 7: 23,928,917 I178V probably benign Het
Vmn1r210 T C 13: 22,827,535 M194V possibly damaging Het
Vmn2r103 A T 17: 19,811,904 T647S probably benign Het
Wdr49 T A 3: 75,339,458 H289L probably benign Het
Wnk2 T G 13: 49,146,683 K184Q probably damaging Het
Zfp758 A G 17: 22,371,997 probably benign Het
Other mutations in Slc19a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0112:Slc19a1 UTSW 10 77042165 missense probably benign 0.04
R0211:Slc19a1 UTSW 10 77038466 missense possibly damaging 0.92
R0419:Slc19a1 UTSW 10 77042908 missense probably damaging 1.00
R1459:Slc19a1 UTSW 10 77042535 nonsense probably null
R1725:Slc19a1 UTSW 10 77041838 missense probably benign 0.03
R2202:Slc19a1 UTSW 10 77041924 missense possibly damaging 0.71
R2203:Slc19a1 UTSW 10 77041924 missense possibly damaging 0.71
R2221:Slc19a1 UTSW 10 77042486 missense probably benign 0.00
R3861:Slc19a1 UTSW 10 77041975 missense possibly damaging 0.88
R3968:Slc19a1 UTSW 10 77041846 missense probably damaging 1.00
R5800:Slc19a1 UTSW 10 77042269 missense probably null 0.00
R6106:Slc19a1 UTSW 10 77044769 missense probably damaging 1.00
R6992:Slc19a1 UTSW 10 77049706 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- CAAAGCCTGTGACTCCTCAG -3'
(R):5'- AGCCTTGGCTTCGACTCTTAAG -3'

Sequencing Primer
(F):5'- AGTGTCCTCTGGCCACCTG -3'
(R):5'- ACTCTTAAGTCTCCCCTGTCG -3'
Posted On2018-06-06