Incidental Mutation 'R6501:Skiv2l'
ID519752
Institutional Source Beutler Lab
Gene Symbol Skiv2l
Ensembl Gene ENSMUSG00000040356
Gene Namesuperkiller viralicidic activity 2-like (S. cerevisiae)
Synonyms4930534J06Rik, Ski2w
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6501 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location34839228-34850210 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34844436 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 622 (S622P)
Ref Sequence ENSEMBL: ENSMUSP00000036265 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046022] [ENSMUST00000172966] [ENSMUST00000173415]
Predicted Effect possibly damaging
Transcript: ENSMUST00000046022
AA Change: S622P

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000036265
Gene: ENSMUSG00000040356
AA Change: S622P

DomainStartEndE-ValueType
low complexity region 7 22 N/A INTRINSIC
low complexity region 171 176 N/A INTRINSIC
low complexity region 208 237 N/A INTRINSIC
low complexity region 269 279 N/A INTRINSIC
DEXDc 304 487 3.61e-28 SMART
low complexity region 583 592 N/A INTRINSIC
HELICc 619 705 8.63e-17 SMART
Pfam:rRNA_proc-arch 760 1044 9.7e-39 PFAM
DSHCT 1067 1243 7.67e-77 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172686
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172803
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172878
Predicted Effect probably benign
Transcript: ENSMUST00000172966
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173305
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173403
Predicted Effect probably benign
Transcript: ENSMUST00000173415
SMART Domains Protein: ENSMUSP00000134209
Gene: ENSMUSG00000040356

DomainStartEndE-ValueType
PDB:4A4Z|A 10 81 8e-14 PDB
Blast:DEXDc 19 76 2e-29 BLAST
Blast:DEXDc 136 242 9e-28 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174226
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174363
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174887
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183497
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184474
Meta Mutation Damage Score 0.078 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein, which is a human homologue of yeast SKI2 and may be involved in antiviral activity by blocking translation of poly(A) deficient mRNAs. This gene is located in the class III region of the major histocompatibility complex. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E6. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd8 A T 8: 71,461,521 C154* probably null Het
Ada A G 2: 163,728,188 probably null Het
Birc6 G A 17: 74,579,281 V535I probably damaging Het
Bptf T C 11: 107,077,683 N1058S probably null Het
Cdadc1 C T 14: 59,586,449 C198Y probably benign Het
Chrna7 G A 7: 63,106,115 R228C probably damaging Het
Cts6 T C 13: 61,196,335 N301S probably damaging Het
Cts8 T A 13: 61,250,942 D250V probably damaging Het
Cyp26a1 G T 19: 37,699,070 R235L possibly damaging Het
Disc1 A T 8: 125,218,105 M598L probably benign Het
Ear6 T A 14: 51,854,224 V76D possibly damaging Het
Grifin A G 5: 140,563,281 *145R probably null Het
Htr2b T G 1: 86,110,641 E11A probably damaging Het
Krtap4-9 T A 11: 99,785,429 probably benign Het
Larp4b A C 13: 9,168,793 H522P probably damaging Het
Macf1 A T 4: 123,469,632 probably null Het
Mdfic T C 6: 15,770,517 L174P possibly damaging Het
Mmp17 A G 5: 129,606,405 E535G probably benign Het
Nfxl1 A T 5: 72,528,509 probably null Het
Nynrin A T 14: 55,863,532 T260S probably benign Het
Olfr1294 C T 2: 111,537,779 G170D probably damaging Het
Olfr859 A T 9: 19,808,975 Y219F possibly damaging Het
Olfr905 A T 9: 38,473,289 I181F possibly damaging Het
Pbx1 G T 1: 168,209,534 D109E probably damaging Het
Pde4d A T 13: 109,116,942 H101L probably benign Het
Pdlim3 T C 8: 45,908,602 I155T possibly damaging Het
Plekha5 T A 6: 140,525,929 Y26* probably null Het
Prpf6 T A 2: 181,621,920 L191* probably null Het
Rabl6 A G 2: 25,602,447 V80A possibly damaging Het
Rp1 T C 1: 4,311,280 probably benign Het
Sec14l1 A G 11: 117,156,850 S698G probably damaging Het
Slc19a1 G A 10: 77,049,606 G447S probably benign Het
Slc2a6 A T 2: 27,023,131 Y383* probably null Het
Slc9a9 C A 9: 94,936,371 Q273K probably benign Het
Spint2 A G 7: 29,263,706 Y56H probably damaging Het
Sspo T A 6: 48,495,212 M123K possibly damaging Het
Syne2 A G 12: 76,027,847 probably null Het
Trdn A C 10: 33,466,454 K619N probably benign Het
Ttll13 A G 7: 80,250,176 T119A possibly damaging Het
Ttn T C 2: 76,785,646 Y8324C probably damaging Het
Ttn T C 2: 76,898,258 probably benign Het
Vav2 A G 2: 27,296,219 L208P probably damaging Het
Vmn1r179 A G 7: 23,928,917 I178V probably benign Het
Vmn1r210 T C 13: 22,827,535 M194V possibly damaging Het
Vmn2r103 A T 17: 19,811,904 T647S probably benign Het
Wdr49 T A 3: 75,339,458 H289L probably benign Het
Wnk2 T G 13: 49,146,683 K184Q probably damaging Het
Zfp758 A G 17: 22,371,997 probably benign Het
Other mutations in Skiv2l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:Skiv2l APN 17 34839548 missense probably damaging 1.00
IGL00338:Skiv2l APN 17 34846667 missense probably damaging 0.99
IGL01284:Skiv2l APN 17 34839688 unclassified probably benign
IGL01308:Skiv2l APN 17 34840634 missense probably benign 0.19
IGL01874:Skiv2l APN 17 34841209 missense probably benign
IGL02114:Skiv2l APN 17 34841116 missense probably damaging 0.97
IGL02208:Skiv2l APN 17 34841675 missense probably damaging 0.99
IGL02274:Skiv2l APN 17 34845863 missense probably damaging 1.00
IGL02729:Skiv2l APN 17 34839605 missense possibly damaging 0.63
IGL02839:Skiv2l APN 17 34847798 missense probably benign
R0325:Skiv2l UTSW 17 34844815 missense possibly damaging 0.50
R1102:Skiv2l UTSW 17 34840106 missense probably benign 0.28
R1294:Skiv2l UTSW 17 34841064 splice site probably null
R1513:Skiv2l UTSW 17 34847444 missense probably damaging 1.00
R1557:Skiv2l UTSW 17 34848422 missense probably damaging 1.00
R1747:Skiv2l UTSW 17 34847806 missense probably benign 0.02
R2401:Skiv2l UTSW 17 34840385 missense probably benign
R3162:Skiv2l UTSW 17 34847813 nonsense probably null
R3162:Skiv2l UTSW 17 34847813 nonsense probably null
R3695:Skiv2l UTSW 17 34847912 missense probably damaging 1.00
R3700:Skiv2l UTSW 17 34849903 missense probably benign
R4654:Skiv2l UTSW 17 34849946 missense probably damaging 1.00
R4736:Skiv2l UTSW 17 34848197 missense possibly damaging 0.91
R4835:Skiv2l UTSW 17 34842921 missense possibly damaging 0.66
R5014:Skiv2l UTSW 17 34847425 missense probably benign 0.00
R5181:Skiv2l UTSW 17 34844826 missense probably benign 0.44
R5223:Skiv2l UTSW 17 34845166 critical splice donor site probably null
R5417:Skiv2l UTSW 17 34846598 missense probably damaging 0.98
R5623:Skiv2l UTSW 17 34847432 missense probably benign 0.00
R5878:Skiv2l UTSW 17 34846117 missense possibly damaging 0.83
R5979:Skiv2l UTSW 17 34841463 missense probably benign 0.01
R6412:Skiv2l UTSW 17 34840300 missense possibly damaging 0.92
R6532:Skiv2l UTSW 17 34844743 missense probably damaging 1.00
R6730:Skiv2l UTSW 17 34845190 nonsense probably null
R6732:Skiv2l UTSW 17 34845190 nonsense probably null
R6741:Skiv2l UTSW 17 34845190 nonsense probably null
R6742:Skiv2l UTSW 17 34845190 nonsense probably null
R6769:Skiv2l UTSW 17 34845190 nonsense probably null
R6771:Skiv2l UTSW 17 34845190 nonsense probably null
R7022:Skiv2l UTSW 17 34845207 missense possibly damaging 0.88
R7096:Skiv2l UTSW 17 34841470 missense probably benign
R7178:Skiv2l UTSW 17 34839464 missense probably benign
R7315:Skiv2l UTSW 17 34841169 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTAACCACTGCACTGTCCTG -3'
(R):5'- GTGAGATCCACCTCTTCCTG -3'

Sequencing Primer
(F):5'- ACTGCACTGTCCTGCCTGAG -3'
(R):5'- ACCCCAGGTGTGTGTCTGTAAATAC -3'
Posted On2018-06-06