Incidental Mutation 'R6502:Tbc1d17'
ID519792
Institutional Source Beutler Lab
Gene Symbol Tbc1d17
Ensembl Gene ENSMUSG00000038520
Gene NameTBC1 domain family, member 17
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.229) question?
Stock #R6502 (G1)
Quality Score221.009
Status Not validated
Chromosome7
Chromosomal Location44834623-44849079 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 44841625 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 555 (I555T)
Ref Sequence ENSEMBL: ENSMUSP00000048260 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033015] [ENSMUST00000047085] [ENSMUST00000118125] [ENSMUST00000145959] [ENSMUST00000207293]
Predicted Effect probably benign
Transcript: ENSMUST00000033015
SMART Domains Protein: ENSMUSP00000033015
Gene: ENSMUSG00000074141

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:AlaDh_PNT_C 42 93 1.3e-9 PFAM
Pfam:Thi4 53 100 1.8e-8 PFAM
Pfam:FAD_binding_3 59 94 1.4e-7 PFAM
Pfam:HI0933_like 59 161 1.3e-8 PFAM
Pfam:FAD_binding_2 60 100 1.5e-8 PFAM
Pfam:Pyr_redox 60 100 1.9e-8 PFAM
Pfam:Pyr_redox_2 60 125 7.3e-8 PFAM
Pfam:DAO 60 140 2.8e-9 PFAM
Pfam:NAD_binding_8 63 130 3.6e-17 PFAM
Pfam:Amino_oxidase 68 503 9.9e-86 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000047085
AA Change: I555T

PolyPhen 2 Score 0.299 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000048260
Gene: ENSMUSG00000038520
AA Change: I555T

DomainStartEndE-ValueType
Pfam:DUF3548 3 217 8.2e-93 PFAM
low complexity region 249 259 N/A INTRINSIC
TBC 307 545 3.93e-54 SMART
Blast:TBC 554 594 1e-6 BLAST
low complexity region 597 631 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118125
SMART Domains Protein: ENSMUSP00000113726
Gene: ENSMUSG00000074141

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:AlaDh_PNT_C 47 111 6.6e-9 PFAM
Pfam:Pyr_redox_2 47 111 2e-9 PFAM
Pfam:HI0933_like 67 169 1.8e-8 PFAM
Pfam:FAD_binding_2 68 108 5e-8 PFAM
Pfam:Pyr_redox 68 109 8.5e-8 PFAM
Pfam:DAO 68 159 5.6e-8 PFAM
Pfam:NAD_binding_8 71 138 1.2e-15 PFAM
Pfam:Amino_oxidase 76 511 5.9e-84 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124695
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130081
Predicted Effect probably benign
Transcript: ENSMUST00000133279
SMART Domains Protein: ENSMUSP00000133613
Gene: ENSMUSG00000074141

DomainStartEndE-ValueType
PDB:1TDO|A 2 44 1e-8 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139947
Predicted Effect probably benign
Transcript: ENSMUST00000145959
SMART Domains Protein: ENSMUSP00000121546
Gene: ENSMUSG00000038520

DomainStartEndE-ValueType
Pfam:DUF3548 3 217 5.8e-93 PFAM
low complexity region 249 259 N/A INTRINSIC
TBC 307 544 3.91e-40 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149686
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149921
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153161
Predicted Effect probably benign
Transcript: ENSMUST00000207293
Predicted Effect probably benign
Transcript: ENSMUST00000208714
Predicted Effect probably benign
Transcript: ENSMUST00000208890
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013D24Rik A T 6: 124,356,949 I24K probably benign Het
Adamts9 A T 6: 92,872,335 C467S probably damaging Het
Adcy7 G A 8: 88,325,479 R925Q probably damaging Het
Akap6 G A 12: 53,140,215 G1471S probably damaging Het
Ap2b1 T C 11: 83,342,679 V506A probably damaging Het
Apob A G 12: 8,001,814 I1113M probably damaging Het
Arsg A T 11: 109,517,336 N105Y probably damaging Het
Blm T A 7: 80,481,475 Y872F probably damaging Het
Btaf1 A T 19: 36,983,617 N797Y probably benign Het
Camsap1 T C 2: 25,956,308 E201G probably damaging Het
Ccdc122 T A 14: 77,042,069 probably null Homo
Ccdc141 A G 2: 77,170,401 V29A probably damaging Het
Cd244 T A 1: 171,577,879 D277E probably benign Het
Cfap157 T C 2: 32,780,678 Y186C probably damaging Het
Ciita C T 16: 10,511,910 A686V probably damaging Het
Clptm1l T C 13: 73,617,765 probably null Het
Col16a1 C T 4: 130,055,994 P50L probably damaging Het
Crisp3 A T 17: 40,235,913 V38D probably damaging Het
Cyfip2 T C 11: 46,221,346 E1010G probably damaging Het
Dvl3 G A 16: 20,527,383 E488K probably damaging Het
Eed C A 7: 89,977,029 E45D probably benign Het
Eln A G 5: 134,725,774 probably benign Het
Fah T A 7: 84,594,835 I239F probably damaging Het
Fbxw5 T A 2: 25,502,436 Y77N possibly damaging Het
Garnl3 T C 2: 33,006,821 E602G possibly damaging Het
Gkn3 A T 6: 87,388,804 M11K probably benign Het
Glt1d1 A G 5: 127,706,981 Y333C probably damaging Het
Gm10762 A T 2: 128,967,170 Y86* probably null Het
Gm14496 A G 2: 182,000,593 M686V probably benign Het
Gse1 T A 8: 120,553,689 probably null Het
Herc4 C A 10: 63,317,418 T1035K probably benign Het
Hmcn2 T A 2: 31,382,478 N1323K probably damaging Het
Hnrnpd T A 5: 99,966,166 E3D probably damaging Het
Htr7 T A 19: 35,969,610 I335F probably damaging Het
Itgae A T 11: 73,145,592 I1119F probably benign Het
Lcn11 T C 2: 25,779,091 F137S probably benign Het
Lrp3 T G 7: 35,203,988 D311A possibly damaging Het
Lrrc1 G T 9: 77,442,191 D364E probably damaging Het
Lrrc37a T A 11: 103,492,179 E2456V unknown Het
Lrriq1 T C 10: 103,227,184 Y87C probably damaging Het
Mcc A T 18: 44,468,390 L449* probably null Het
Mcc A T 18: 44,468,391 L624M probably damaging Het
Mcm9 T C 10: 53,612,839 T496A probably damaging Het
Myef2 T A 2: 125,116,682 D109V probably damaging Het
Myom3 C T 4: 135,762,513 probably benign Het
Nanos1 G T 19: 60,756,539 G92W possibly damaging Het
Ncor1 T A 11: 62,381,414 K84* probably null Het
Neb T A 2: 52,291,082 D1171V probably benign Het
Notch3 A G 17: 32,158,217 W267R probably damaging Het
Olfr1167 A T 2: 88,150,016 M1K probably null Het
Olfr26 A C 9: 38,855,637 T192P probably damaging Het
Per2 A G 1: 91,427,763 S758P probably benign Het
Pi4k2a A G 19: 42,090,932 Q144R probably benign Het
Pirb A T 7: 3,717,393 V327E probably benign Het
Pla2g4a C T 1: 149,872,616 W272* probably null Het
Plekha4 T A 7: 45,530,576 M1K probably null Het
Ppt2 A G 17: 34,625,920 C117R probably damaging Het
Prph A T 15: 99,056,386 I222F probably damaging Het
Rbm43 T C 2: 51,925,576 D211G probably damaging Het
Rims2 A G 15: 39,534,855 D1072G probably benign Het
Rnf123 G T 9: 108,068,332 Q380K possibly damaging Het
Rnf145 T C 11: 44,525,105 F49S probably damaging Het
Sall4 A G 2: 168,755,708 I404T probably damaging Het
Slc25a39 G A 11: 102,404,460 P228L probably damaging Het
Tbc1d14 T C 5: 36,520,481 T377A possibly damaging Het
Tmem131l A T 3: 83,922,408 S980T probably damaging Het
Tmem14a G T 1: 21,229,438 L97F possibly damaging Het
Tmem98 T C 11: 80,812,635 V26A probably benign Het
Tmppe G T 9: 114,405,652 G340W probably damaging Het
Tsc1 T C 2: 28,665,601 S237P probably damaging Het
Ttc30b T A 2: 75,937,104 N435I possibly damaging Het
Ubr4 C T 4: 139,444,671 R2992W probably damaging Het
Ugt2a2 A G 5: 87,460,459 V673A possibly damaging Het
Vmn2r19 T C 6: 123,316,108 Y370H possibly damaging Het
Vmn2r20 A G 6: 123,396,383 F500S possibly damaging Het
Zc3h7b A G 15: 81,769,051 Y47C probably benign Het
Zdhhc13 A G 7: 48,815,560 E406G possibly damaging Het
Zfp418 T C 7: 7,182,600 S521P possibly damaging Het
Other mutations in Tbc1d17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00753:Tbc1d17 APN 7 44843085 missense probably benign 0.00
IGL00791:Tbc1d17 APN 7 44845313 missense probably benign 0.04
IGL01865:Tbc1d17 APN 7 44842689 missense possibly damaging 0.90
IGL02468:Tbc1d17 APN 7 44848329 missense probably benign
IGL02829:Tbc1d17 APN 7 44848872 unclassified probably benign
PIT4431001:Tbc1d17 UTSW 7 44845074 missense probably benign
R0035:Tbc1d17 UTSW 7 44841408 missense probably benign 0.09
R0035:Tbc1d17 UTSW 7 44841408 missense probably benign 0.09
R0066:Tbc1d17 UTSW 7 44844071 unclassified probably benign
R0066:Tbc1d17 UTSW 7 44844071 unclassified probably benign
R0414:Tbc1d17 UTSW 7 44846059 missense probably benign 0.00
R0574:Tbc1d17 UTSW 7 44843123 unclassified probably benign
R0626:Tbc1d17 UTSW 7 44843085 missense probably benign 0.00
R0960:Tbc1d17 UTSW 7 44848428 splice site probably benign
R1203:Tbc1d17 UTSW 7 44843471 missense probably damaging 1.00
R1244:Tbc1d17 UTSW 7 44844398 missense probably damaging 0.99
R1730:Tbc1d17 UTSW 7 44845131 missense probably damaging 0.99
R1783:Tbc1d17 UTSW 7 44845131 missense probably damaging 0.99
R1899:Tbc1d17 UTSW 7 44841633 unclassified probably benign
R1953:Tbc1d17 UTSW 7 44841398 unclassified probably null
R2106:Tbc1d17 UTSW 7 44848268 critical splice donor site probably null
R3889:Tbc1d17 UTSW 7 44845938 missense probably damaging 1.00
R4240:Tbc1d17 UTSW 7 44846826 missense probably damaging 1.00
R4547:Tbc1d17 UTSW 7 44841347 missense probably benign
R4787:Tbc1d17 UTSW 7 44843064 missense probably benign 0.02
R5422:Tbc1d17 UTSW 7 44848868 start codon destroyed probably null 0.98
R5569:Tbc1d17 UTSW 7 44848331 missense probably damaging 1.00
R5933:Tbc1d17 UTSW 7 44845337 missense probably damaging 0.96
R6838:Tbc1d17 UTSW 7 44844314 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TCCAAGAGGCTAGTTGATGGG -3'
(R):5'- CCACTTACCAGGTTACTAGGCTG -3'

Sequencing Primer
(F):5'- CAAGAGGCTAGTTGATGGGTGAGG -3'
(R):5'- CCAGGTTACTAGGCTGTACTTATAG -3'
Posted On2018-06-06