Incidental Mutation 'R6502:Lrrc1'
ID519801
Institutional Source Beutler Lab
Gene Symbol Lrrc1
Ensembl Gene ENSMUSG00000032352
Gene Nameleucine rich repeat containing 1
SynonymsA430093J20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.219) question?
Stock #R6502 (G1)
Quality Score190.009
Status Not validated
Chromosome9
Chromosomal Location77430823-77544870 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 77442191 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 364 (D364E)
Ref Sequence ENSEMBL: ENSMUSP00000139226 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113421] [ENSMUST00000183873]
Predicted Effect probably benign
Transcript: ENSMUST00000113421
AA Change: D319E

PolyPhen 2 Score 0.364 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000109048
Gene: ENSMUSG00000032352
AA Change: D319E

DomainStartEndE-ValueType
LRR 13 35 6.57e-1 SMART
LRR 36 59 1.12e2 SMART
LRR 82 104 2.15e2 SMART
LRR 105 127 3.09e1 SMART
LRR 128 150 2.14e0 SMART
LRR 151 173 3.02e0 SMART
LRR 174 196 3.47e0 SMART
LRR 197 219 6.58e0 SMART
LRR_TYP 220 243 4.72e-2 SMART
LRR 266 289 8.97e0 SMART
LRR 313 335 1.49e2 SMART
coiled coil region 440 461 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000183467
AA Change: D1E
Predicted Effect probably damaging
Transcript: ENSMUST00000183873
AA Change: D364E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139226
Gene: ENSMUSG00000032352
AA Change: D364E

DomainStartEndE-ValueType
LRR 36 57 3.18e1 SMART
LRR 58 80 6.57e-1 SMART
LRR 81 104 1.12e2 SMART
LRR 127 149 2.15e2 SMART
LRR 150 172 3.09e1 SMART
LRR 173 195 2.14e0 SMART
LRR 196 218 3.02e0 SMART
LRR 219 241 3.47e0 SMART
LRR 242 264 6.58e0 SMART
LRR_TYP 265 288 4.72e-2 SMART
LRR 311 334 8.97e0 SMART
LRR 358 380 1.49e2 SMART
coiled coil region 485 506 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184099
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013D24Rik A T 6: 124,356,949 I24K probably benign Het
Adamts9 A T 6: 92,872,335 C467S probably damaging Het
Adcy7 G A 8: 88,325,479 R925Q probably damaging Het
Akap6 G A 12: 53,140,215 G1471S probably damaging Het
Ap2b1 T C 11: 83,342,679 V506A probably damaging Het
Apob A G 12: 8,001,814 I1113M probably damaging Het
Arsg A T 11: 109,517,336 N105Y probably damaging Het
Blm T A 7: 80,481,475 Y872F probably damaging Het
Btaf1 A T 19: 36,983,617 N797Y probably benign Het
Camsap1 T C 2: 25,956,308 E201G probably damaging Het
Ccdc122 T A 14: 77,042,069 probably null Homo
Ccdc141 A G 2: 77,170,401 V29A probably damaging Het
Cd244 T A 1: 171,577,879 D277E probably benign Het
Cfap157 T C 2: 32,780,678 Y186C probably damaging Het
Ciita C T 16: 10,511,910 A686V probably damaging Het
Clptm1l T C 13: 73,617,765 probably null Het
Col16a1 C T 4: 130,055,994 P50L probably damaging Het
Crisp3 A T 17: 40,235,913 V38D probably damaging Het
Cyfip2 T C 11: 46,221,346 E1010G probably damaging Het
Dvl3 G A 16: 20,527,383 E488K probably damaging Het
Eed C A 7: 89,977,029 E45D probably benign Het
Eln A G 5: 134,725,774 probably benign Het
Fah T A 7: 84,594,835 I239F probably damaging Het
Fbxw5 T A 2: 25,502,436 Y77N possibly damaging Het
Garnl3 T C 2: 33,006,821 E602G possibly damaging Het
Gkn3 A T 6: 87,388,804 M11K probably benign Het
Glt1d1 A G 5: 127,706,981 Y333C probably damaging Het
Gm10762 A T 2: 128,967,170 Y86* probably null Het
Gm14496 A G 2: 182,000,593 M686V probably benign Het
Gse1 T A 8: 120,553,689 probably null Het
Herc4 C A 10: 63,317,418 T1035K probably benign Het
Hmcn2 T A 2: 31,382,478 N1323K probably damaging Het
Hnrnpd T A 5: 99,966,166 E3D probably damaging Het
Htr7 T A 19: 35,969,610 I335F probably damaging Het
Itgae A T 11: 73,145,592 I1119F probably benign Het
Lcn11 T C 2: 25,779,091 F137S probably benign Het
Lrp3 T G 7: 35,203,988 D311A possibly damaging Het
Lrrc37a T A 11: 103,492,179 E2456V unknown Het
Lrriq1 T C 10: 103,227,184 Y87C probably damaging Het
Mcc A T 18: 44,468,390 L449* probably null Het
Mcc A T 18: 44,468,391 L624M probably damaging Het
Mcm9 T C 10: 53,612,839 T496A probably damaging Het
Myef2 T A 2: 125,116,682 D109V probably damaging Het
Myom3 C T 4: 135,762,513 probably benign Het
Nanos1 G T 19: 60,756,539 G92W possibly damaging Het
Ncor1 T A 11: 62,381,414 K84* probably null Het
Neb T A 2: 52,291,082 D1171V probably benign Het
Notch3 A G 17: 32,158,217 W267R probably damaging Het
Olfr1167 A T 2: 88,150,016 M1K probably null Het
Olfr26 A C 9: 38,855,637 T192P probably damaging Het
Per2 A G 1: 91,427,763 S758P probably benign Het
Pi4k2a A G 19: 42,090,932 Q144R probably benign Het
Pirb A T 7: 3,717,393 V327E probably benign Het
Pla2g4a C T 1: 149,872,616 W272* probably null Het
Plekha4 T A 7: 45,530,576 M1K probably null Het
Ppt2 A G 17: 34,625,920 C117R probably damaging Het
Prph A T 15: 99,056,386 I222F probably damaging Het
Rbm43 T C 2: 51,925,576 D211G probably damaging Het
Rims2 A G 15: 39,534,855 D1072G probably benign Het
Rnf123 G T 9: 108,068,332 Q380K possibly damaging Het
Rnf145 T C 11: 44,525,105 F49S probably damaging Het
Sall4 A G 2: 168,755,708 I404T probably damaging Het
Slc25a39 G A 11: 102,404,460 P228L probably damaging Het
Tbc1d14 T C 5: 36,520,481 T377A possibly damaging Het
Tbc1d17 A G 7: 44,841,625 I555T probably benign Het
Tmem131l A T 3: 83,922,408 S980T probably damaging Het
Tmem14a G T 1: 21,229,438 L97F possibly damaging Het
Tmem98 T C 11: 80,812,635 V26A probably benign Het
Tmppe G T 9: 114,405,652 G340W probably damaging Het
Tsc1 T C 2: 28,665,601 S237P probably damaging Het
Ttc30b T A 2: 75,937,104 N435I possibly damaging Het
Ubr4 C T 4: 139,444,671 R2992W probably damaging Het
Ugt2a2 A G 5: 87,460,459 V673A possibly damaging Het
Vmn2r19 T C 6: 123,316,108 Y370H possibly damaging Het
Vmn2r20 A G 6: 123,396,383 F500S possibly damaging Het
Zc3h7b A G 15: 81,769,051 Y47C probably benign Het
Zdhhc13 A G 7: 48,815,560 E406G possibly damaging Het
Zfp418 T C 7: 7,182,600 S521P possibly damaging Het
Other mutations in Lrrc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02556:Lrrc1 APN 9 77435122 missense probably benign 0.00
IGL02975:Lrrc1 APN 9 77452647 missense probably damaging 1.00
IGL03063:Lrrc1 APN 9 77499269 missense probably damaging 0.99
R0610:Lrrc1 UTSW 9 77472206 missense possibly damaging 0.95
R1462:Lrrc1 UTSW 9 77442265 missense probably benign 0.01
R1462:Lrrc1 UTSW 9 77442265 missense probably benign 0.01
R1615:Lrrc1 UTSW 9 77435118 missense possibly damaging 0.94
R2932:Lrrc1 UTSW 9 77457439 missense probably benign 0.01
R5087:Lrrc1 UTSW 9 77457458 missense probably benign
R5907:Lrrc1 UTSW 9 77434097 missense probably damaging 0.99
R6443:Lrrc1 UTSW 9 77434032 missense probably damaging 1.00
R7073:Lrrc1 UTSW 9 77468565 missense probably benign 0.04
R7162:Lrrc1 UTSW 9 77432190 missense probably benign 0.13
R7177:Lrrc1 UTSW 9 77472222 nonsense probably null
R7290:Lrrc1 UTSW 9 77457839 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCTGCTCTGAAGTAGCCCAG -3'
(R):5'- GACCATCGGTGAAGTTTAAACATC -3'

Sequencing Primer
(F):5'- CTCTGAAGTAGCCCAGGGTGTG -3'
(R):5'- AAACATCATATGCTTCTTCATGCC -3'
Posted On2018-06-06