Incidental Mutation 'R6502:Ppt2'
ID519826
Institutional Source Beutler Lab
Gene Symbol Ppt2
Ensembl Gene ENSMUSG00000015474
Gene Namepalmitoyl-protein thioesterase 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6502 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location34616662-34628510 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34625920 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 117 (C117R)
Ref Sequence ENSEMBL: ENSMUSP00000131243 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015620] [ENSMUST00000064953] [ENSMUST00000166040] [ENSMUST00000167097] [ENSMUST00000168391] [ENSMUST00000169067] [ENSMUST00000169287] [ENSMUST00000170345] [ENSMUST00000171121] [ENSMUST00000171376]
Predicted Effect probably benign
Transcript: ENSMUST00000015620
SMART Domains Protein: ENSMUSP00000015620
Gene: ENSMUSG00000015476

DomainStartEndE-ValueType
low complexity region 17 38 N/A INTRINSIC
low complexity region 41 49 N/A INTRINSIC
low complexity region 57 79 N/A INTRINSIC
low complexity region 84 100 N/A INTRINSIC
low complexity region 121 144 N/A INTRINSIC
Pfam:CD225 214 286 3.5e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000064953
AA Change: C117R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000068071
Gene: ENSMUSG00000015474
AA Change: C117R

DomainStartEndE-ValueType
low complexity region 9 31 N/A INTRINSIC
Pfam:Palm_thioest 34 297 2.2e-19 PFAM
Pfam:Abhydrolase_6 39 273 2.5e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000166040
AA Change: C117R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132006
Gene: ENSMUSG00000015474
AA Change: C117R

DomainStartEndE-ValueType
low complexity region 9 31 N/A INTRINSIC
Pfam:Palm_thioest 34 289 9e-19 PFAM
Pfam:Abhydrolase_1 37 173 9e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000167097
AA Change: C117R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125937
Gene: ENSMUSG00000015474
AA Change: C117R

DomainStartEndE-ValueType
low complexity region 9 31 N/A INTRINSIC
Pfam:Palm_thioest 34 236 7.7e-12 PFAM
Pfam:Abhydrolase_6 39 236 2.1e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000168391
AA Change: C117R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132339
Gene: ENSMUSG00000015474
AA Change: C117R

DomainStartEndE-ValueType
low complexity region 9 31 N/A INTRINSIC
Pfam:Palm_thioest 34 297 2.2e-19 PFAM
Pfam:Abhydrolase_6 39 273 2.5e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168709
Predicted Effect probably damaging
Transcript: ENSMUST00000169067
AA Change: C117R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127372
Gene: ENSMUSG00000015474
AA Change: C117R

DomainStartEndE-ValueType
low complexity region 9 31 N/A INTRINSIC
Pfam:Palm_thioest 34 297 2.2e-19 PFAM
Pfam:Abhydrolase_6 39 273 2.5e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169287
SMART Domains Protein: ENSMUSP00000129421
Gene: ENSMUSG00000015474

DomainStartEndE-ValueType
PDB:1PJA|A 1 102 2e-42 PDB
SCOP:d1fj2a_ 29 91 7e-3 SMART
Predicted Effect unknown
Transcript: ENSMUST00000169969
AA Change: C97R
SMART Domains Protein: ENSMUSP00000127726
Gene: ENSMUSG00000015474
AA Change: C97R

DomainStartEndE-ValueType
low complexity region 1 12 N/A INTRINSIC
Pfam:Abhydrolase_1 18 139 9e-8 PFAM
Pfam:Palm_thioest 116 234 1.5e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000170345
AA Change: C117R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127707
Gene: ENSMUSG00000015474
AA Change: C117R

DomainStartEndE-ValueType
low complexity region 9 31 N/A INTRINSIC
Pfam:Palm_thioest 33 203 1.6e-9 PFAM
Pfam:Abhydrolase_6 39 201 2.2e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000171121
AA Change: C117R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127745
Gene: ENSMUSG00000015474
AA Change: C117R

DomainStartEndE-ValueType
low complexity region 9 31 N/A INTRINSIC
Pfam:Palm_thioest 34 297 2.2e-19 PFAM
Pfam:Abhydrolase_6 39 273 2.5e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000171376
AA Change: C117R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131243
Gene: ENSMUSG00000015474
AA Change: C117R

DomainStartEndE-ValueType
low complexity region 9 31 N/A INTRINSIC
Pfam:Palm_thioest 34 297 2.2e-19 PFAM
Pfam:Abhydrolase_6 39 273 2.5e-10 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the palmitoyl-protein thioesterase family. The encoded glycosylated lysosomal protein has palmitoyl-CoA hydrolase activity in vitro, but does not hydrolyze palmitate from cysteine residues in proteins. Alternative splicing results in multiple transcript variants. Read-through transcription also exists between this gene and the downstream EGFL8 (EGF-like-domain, multiple 8) gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygous null mutants show autofluorescent storage material in brain, abnormal clasping behavior, spasticity, ataxia and increased adult mortality. In addition, lipofuscin pigments in pancreas, bone marrow histiocytosis and splenomegaly are observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013D24Rik A T 6: 124,356,949 I24K probably benign Het
Adamts9 A T 6: 92,872,335 C467S probably damaging Het
Adcy7 G A 8: 88,325,479 R925Q probably damaging Het
Akap6 G A 12: 53,140,215 G1471S probably damaging Het
Ap2b1 T C 11: 83,342,679 V506A probably damaging Het
Apob A G 12: 8,001,814 I1113M probably damaging Het
Arsg A T 11: 109,517,336 N105Y probably damaging Het
Blm T A 7: 80,481,475 Y872F probably damaging Het
Btaf1 A T 19: 36,983,617 N797Y probably benign Het
Camsap1 T C 2: 25,956,308 E201G probably damaging Het
Ccdc122 T A 14: 77,042,069 probably null Homo
Ccdc141 A G 2: 77,170,401 V29A probably damaging Het
Cd244 T A 1: 171,577,879 D277E probably benign Het
Cfap157 T C 2: 32,780,678 Y186C probably damaging Het
Ciita C T 16: 10,511,910 A686V probably damaging Het
Clptm1l T C 13: 73,617,765 probably null Het
Col16a1 C T 4: 130,055,994 P50L probably damaging Het
Crisp3 A T 17: 40,235,913 V38D probably damaging Het
Cyfip2 T C 11: 46,221,346 E1010G probably damaging Het
Dvl3 G A 16: 20,527,383 E488K probably damaging Het
Eed C A 7: 89,977,029 E45D probably benign Het
Eln A G 5: 134,725,774 probably benign Het
Fah T A 7: 84,594,835 I239F probably damaging Het
Fbxw5 T A 2: 25,502,436 Y77N possibly damaging Het
Garnl3 T C 2: 33,006,821 E602G possibly damaging Het
Gkn3 A T 6: 87,388,804 M11K probably benign Het
Glt1d1 A G 5: 127,706,981 Y333C probably damaging Het
Gm10762 A T 2: 128,967,170 Y86* probably null Het
Gm14496 A G 2: 182,000,593 M686V probably benign Het
Gse1 T A 8: 120,553,689 probably null Het
Herc4 C A 10: 63,317,418 T1035K probably benign Het
Hmcn2 T A 2: 31,382,478 N1323K probably damaging Het
Hnrnpd T A 5: 99,966,166 E3D probably damaging Het
Htr7 T A 19: 35,969,610 I335F probably damaging Het
Itgae A T 11: 73,145,592 I1119F probably benign Het
Lcn11 T C 2: 25,779,091 F137S probably benign Het
Lrp3 T G 7: 35,203,988 D311A possibly damaging Het
Lrrc1 G T 9: 77,442,191 D364E probably damaging Het
Lrrc37a T A 11: 103,492,179 E2456V unknown Het
Lrriq1 T C 10: 103,227,184 Y87C probably damaging Het
Mcc A T 18: 44,468,390 L449* probably null Het
Mcc A T 18: 44,468,391 L624M probably damaging Het
Mcm9 T C 10: 53,612,839 T496A probably damaging Het
Myef2 T A 2: 125,116,682 D109V probably damaging Het
Myom3 C T 4: 135,762,513 probably benign Het
Nanos1 G T 19: 60,756,539 G92W possibly damaging Het
Ncor1 T A 11: 62,381,414 K84* probably null Het
Neb T A 2: 52,291,082 D1171V probably benign Het
Notch3 A G 17: 32,158,217 W267R probably damaging Het
Olfr1167 A T 2: 88,150,016 M1K probably null Het
Olfr26 A C 9: 38,855,637 T192P probably damaging Het
Per2 A G 1: 91,427,763 S758P probably benign Het
Pi4k2a A G 19: 42,090,932 Q144R probably benign Het
Pirb A T 7: 3,717,393 V327E probably benign Het
Pla2g4a C T 1: 149,872,616 W272* probably null Het
Plekha4 T A 7: 45,530,576 M1K probably null Het
Prph A T 15: 99,056,386 I222F probably damaging Het
Rbm43 T C 2: 51,925,576 D211G probably damaging Het
Rims2 A G 15: 39,534,855 D1072G probably benign Het
Rnf123 G T 9: 108,068,332 Q380K possibly damaging Het
Rnf145 T C 11: 44,525,105 F49S probably damaging Het
Sall4 A G 2: 168,755,708 I404T probably damaging Het
Slc25a39 G A 11: 102,404,460 P228L probably damaging Het
Tbc1d14 T C 5: 36,520,481 T377A possibly damaging Het
Tbc1d17 A G 7: 44,841,625 I555T probably benign Het
Tmem131l A T 3: 83,922,408 S980T probably damaging Het
Tmem14a G T 1: 21,229,438 L97F possibly damaging Het
Tmem98 T C 11: 80,812,635 V26A probably benign Het
Tmppe G T 9: 114,405,652 G340W probably damaging Het
Tsc1 T C 2: 28,665,601 S237P probably damaging Het
Ttc30b T A 2: 75,937,104 N435I possibly damaging Het
Ubr4 C T 4: 139,444,671 R2992W probably damaging Het
Ugt2a2 A G 5: 87,460,459 V673A possibly damaging Het
Vmn2r19 T C 6: 123,316,108 Y370H possibly damaging Het
Vmn2r20 A G 6: 123,396,383 F500S possibly damaging Het
Zc3h7b A G 15: 81,769,051 Y47C probably benign Het
Zdhhc13 A G 7: 48,815,560 E406G possibly damaging Het
Zfp418 T C 7: 7,182,600 S521P possibly damaging Het
Other mutations in Ppt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02033:Ppt2 APN 17 34625754 splice site probably benign
R0180:Ppt2 UTSW 17 34626503 missense probably damaging 1.00
R0685:Ppt2 UTSW 17 34626572 missense probably damaging 0.98
R1498:Ppt2 UTSW 17 34623101 missense probably benign 0.00
R2058:Ppt2 UTSW 17 34622844 splice site probably benign
R2059:Ppt2 UTSW 17 34622844 splice site probably benign
R3919:Ppt2 UTSW 17 34622923 missense probably damaging 1.00
R4622:Ppt2 UTSW 17 34625901 missense probably benign 0.16
R5582:Ppt2 UTSW 17 34617399 missense probably damaging 0.99
R5638:Ppt2 UTSW 17 34625849 missense probably benign 0.37
R7065:Ppt2 UTSW 17 34622855 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAAAGAGAACCGCCATGCC -3'
(R):5'- TCCAGTGGCTATTCTTAAGACC -3'

Sequencing Primer
(F):5'- CAAGGGCCATCAAATCTCTGTG -3'
(R):5'- TCCAGAGGTCCAGAGTTCAATTC -3'
Posted On2018-06-06