Incidental Mutation 'R6509:Tbc1d4'
ID 519874
Institutional Source Beutler Lab
Gene Symbol Tbc1d4
Ensembl Gene ENSMUSG00000033083
Gene Name TBC1 domain family, member 4
Synonyms AS160, 5930406J04Rik
MMRRC Submission 044422-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6509 (G1)
Quality Score 128.008
Status Not validated
Chromosome 14
Chromosomal Location 101679796-101846627 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 101845754 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 48 (R48L)
Ref Sequence ENSEMBL: ENSMUSP00000124909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100340] [ENSMUST00000161991] [ENSMUST00000162617]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000100340
AA Change: R48L

PolyPhen 2 Score 0.272 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000097913
Gene: ENSMUSG00000033083
AA Change: R48L

DomainStartEndE-ValueType
PTB 31 191 2.08e-29 SMART
PTB 197 457 3.16e-29 SMART
low complexity region 708 720 N/A INTRINSIC
Blast:TBC 773 834 3e-12 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159484
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159668
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160297
Predicted Effect probably benign
Transcript: ENSMUST00000161991
AA Change: R48L

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000125509
Gene: ENSMUSG00000033083
AA Change: R48L

DomainStartEndE-ValueType
PTB 31 191 2.08e-29 SMART
PTB 197 457 3.16e-29 SMART
Pfam:DUF3350 746 809 1.2e-27 PFAM
TBC 860 1080 5.2e-77 SMART
Blast:TBC 1105 1163 1e-23 BLAST
Blast:TBC 1168 1222 1e-20 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000162617
AA Change: R48L

PolyPhen 2 Score 0.916 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000124909
Gene: ENSMUSG00000033083
AA Change: R48L

DomainStartEndE-ValueType
PTB 31 191 2.08e-29 SMART
PTB 197 457 3.16e-29 SMART
low complexity region 708 720 N/A INTRINSIC
Pfam:DUF3350 809 872 3.3e-31 PFAM
TBC 923 1143 5.2e-77 SMART
Blast:TBC 1168 1226 2e-23 BLAST
Blast:TBC 1231 1285 1e-20 BLAST
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.7%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Tre-2/BUB2/CDC16 domain family. The protein encoded by this gene is a Rab-GTPase-activating protein, and contains two phopshotyrosine-binding domains (PTB1 and PTB2), a calmodulin-binding domain (CBD), a Rab-GTPase domain, and multiple AKT phosphomotifs. This protein is thought to play an important role in glucose homeostasis by regulating the insulin-dependent trafficking of the glucose transporter 4 (GLUT4), important for removing glucose from the bloodstream into skeletal muscle and fat tissues. Reduced expression of this gene results in an increase in GLUT4 levels at the plasma membrane, suggesting that this protein is important in intracellular retention of GLUT4 under basal conditions. When exposed to insulin, this protein is phosphorylated, dissociates from GLUT4 vesicles, resulting in increased GLUT4 at the cell surface, and enhanced glucose transport. Phosphorylation of this protein by AKT is required for proper translocation of GLUT4 to the cell surface. Individuals homozygous for a mutation in this gene are at higher risk for type 2 diabetes and have higher levels of circulating glucose and insulin levels after glucose ingestion. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit reduced blood glucose levels under both fasted and fed conditions, insulin resistance in both muscle and liver, decreased energy expenditure and oxygen consumption, abnormal adipocyte and muscle cell glucose uptake, and increased hepatic gluconeogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 16 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik G A 5: 109,885,250 (GRCm39) R203* probably null Het
Ccnc A G 4: 21,740,642 (GRCm39) N133D probably benign Het
Cfap299 C T 5: 98,477,256 (GRCm39) T15I probably benign Het
Lbhd2 A G 12: 111,376,747 (GRCm39) R65G possibly damaging Het
Lrrc37a A G 11: 103,395,240 (GRCm39) S62P probably benign Het
Map3k1 T A 13: 111,890,363 (GRCm39) M1279L possibly damaging Het
Ncapg2 G A 12: 116,391,376 (GRCm39) R475Q probably damaging Het
Nlrp5 A T 7: 23,117,341 (GRCm39) N355I probably damaging Het
Or7g29 A G 9: 19,286,439 (GRCm39) V246A probably benign Het
Pdzd8 A G 19: 59,333,298 (GRCm39) F241S probably benign Het
Rgl3 A G 9: 21,883,204 (GRCm39) S705P probably benign Het
Rsbn1 A G 3: 103,867,348 (GRCm39) Y563C probably damaging Het
Septin9 A G 11: 117,181,253 (GRCm39) I18V probably benign Het
Sycp2 G A 2: 178,037,687 (GRCm39) P153S probably damaging Het
Vmn1r195 G A 13: 22,463,279 (GRCm39) G250R probably benign Het
Vmn2r66 G T 7: 84,656,054 (GRCm39) P321T probably benign Het
Other mutations in Tbc1d4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Tbc1d4 APN 14 101,845,548 (GRCm39) missense probably damaging 1.00
IGL00864:Tbc1d4 APN 14 101,682,002 (GRCm39) missense probably benign 0.23
IGL01065:Tbc1d4 APN 14 101,686,629 (GRCm39) splice site probably benign
IGL01144:Tbc1d4 APN 14 101,682,099 (GRCm39) missense probably damaging 0.99
IGL01153:Tbc1d4 APN 14 101,845,451 (GRCm39) missense possibly damaging 0.52
IGL01472:Tbc1d4 APN 14 101,727,300 (GRCm39) nonsense probably null
IGL02177:Tbc1d4 APN 14 101,692,375 (GRCm39) missense possibly damaging 0.90
IGL02259:Tbc1d4 APN 14 101,703,166 (GRCm39) missense probably damaging 1.00
IGL02938:Tbc1d4 APN 14 101,738,536 (GRCm39) missense probably damaging 1.00
IGL02975:Tbc1d4 APN 14 101,695,549 (GRCm39) missense probably damaging 1.00
R0396:Tbc1d4 UTSW 14 101,695,499 (GRCm39) splice site probably null
R0787:Tbc1d4 UTSW 14 101,686,645 (GRCm39) missense probably damaging 1.00
R0944:Tbc1d4 UTSW 14 101,716,656 (GRCm39) splice site probably benign
R1167:Tbc1d4 UTSW 14 101,845,455 (GRCm39) missense probably damaging 1.00
R1456:Tbc1d4 UTSW 14 101,744,542 (GRCm39) missense probably damaging 1.00
R1465:Tbc1d4 UTSW 14 101,685,124 (GRCm39) missense possibly damaging 0.87
R1465:Tbc1d4 UTSW 14 101,685,124 (GRCm39) missense possibly damaging 0.87
R1672:Tbc1d4 UTSW 14 101,712,651 (GRCm39) missense possibly damaging 0.92
R1762:Tbc1d4 UTSW 14 101,744,574 (GRCm39) missense possibly damaging 0.95
R2057:Tbc1d4 UTSW 14 101,714,591 (GRCm39) missense probably damaging 0.97
R2260:Tbc1d4 UTSW 14 101,731,847 (GRCm39) missense probably damaging 1.00
R2762:Tbc1d4 UTSW 14 101,731,797 (GRCm39) missense probably damaging 1.00
R3814:Tbc1d4 UTSW 14 101,696,191 (GRCm39) missense possibly damaging 0.94
R3983:Tbc1d4 UTSW 14 101,744,649 (GRCm39) missense probably benign 0.00
R4498:Tbc1d4 UTSW 14 101,845,772 (GRCm39) missense probably damaging 1.00
R4580:Tbc1d4 UTSW 14 101,696,219 (GRCm39) missense probably benign 0.00
R4664:Tbc1d4 UTSW 14 101,700,263 (GRCm39) intron probably benign
R4872:Tbc1d4 UTSW 14 101,682,144 (GRCm39) missense probably benign 0.06
R4940:Tbc1d4 UTSW 14 101,744,667 (GRCm39) missense probably benign 0.27
R4964:Tbc1d4 UTSW 14 101,695,610 (GRCm39) missense probably damaging 1.00
R4966:Tbc1d4 UTSW 14 101,695,610 (GRCm39) missense probably damaging 1.00
R5103:Tbc1d4 UTSW 14 101,696,318 (GRCm39) nonsense probably null
R5180:Tbc1d4 UTSW 14 101,745,008 (GRCm39) missense probably damaging 1.00
R5366:Tbc1d4 UTSW 14 101,845,412 (GRCm39) missense possibly damaging 0.67
R5673:Tbc1d4 UTSW 14 101,692,444 (GRCm39) missense probably damaging 1.00
R6057:Tbc1d4 UTSW 14 101,727,353 (GRCm39) missense probably damaging 0.99
R6180:Tbc1d4 UTSW 14 101,696,206 (GRCm39) missense probably benign 0.01
R6361:Tbc1d4 UTSW 14 101,744,610 (GRCm39) missense probably damaging 0.97
R6791:Tbc1d4 UTSW 14 101,845,695 (GRCm39) missense probably damaging 0.98
R7001:Tbc1d4 UTSW 14 101,696,185 (GRCm39) missense probably benign 0.43
R7016:Tbc1d4 UTSW 14 101,724,877 (GRCm39) missense probably damaging 1.00
R7575:Tbc1d4 UTSW 14 101,685,025 (GRCm39) missense probably damaging 1.00
R7691:Tbc1d4 UTSW 14 101,745,077 (GRCm39) missense probably damaging 1.00
R7936:Tbc1d4 UTSW 14 101,703,190 (GRCm39) missense probably damaging 1.00
R7991:Tbc1d4 UTSW 14 101,845,715 (GRCm39) missense probably damaging 0.98
R8182:Tbc1d4 UTSW 14 101,744,990 (GRCm39) missense probably damaging 1.00
R8540:Tbc1d4 UTSW 14 101,845,712 (GRCm39) missense probably damaging 1.00
R9126:Tbc1d4 UTSW 14 101,724,952 (GRCm39) missense probably benign 0.01
R9282:Tbc1d4 UTSW 14 101,845,616 (GRCm39) missense possibly damaging 0.93
R9288:Tbc1d4 UTSW 14 101,692,308 (GRCm39) missense probably damaging 1.00
R9385:Tbc1d4 UTSW 14 101,700,356 (GRCm39) missense probably damaging 1.00
R9424:Tbc1d4 UTSW 14 101,703,096 (GRCm39) missense probably damaging 1.00
R9494:Tbc1d4 UTSW 14 101,845,895 (GRCm39) start codon destroyed probably null 0.90
R9655:Tbc1d4 UTSW 14 101,744,567 (GRCm39) missense probably damaging 1.00
R9658:Tbc1d4 UTSW 14 101,845,856 (GRCm39) missense probably damaging 0.98
R9712:Tbc1d4 UTSW 14 101,744,846 (GRCm39) missense probably benign
Z1088:Tbc1d4 UTSW 14 101,689,859 (GRCm39) missense probably damaging 1.00
Z1176:Tbc1d4 UTSW 14 101,744,523 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CTTGTGCTCGAAGATGAACAC -3'
(R):5'- TCCTGCACAGTGAGAGTTGG -3'

Sequencing Primer
(F):5'- TCGAAGATGAACACCCCGG -3'
(R):5'- CAGTGAGAGTTGGGGGCG -3'
Posted On 2018-06-06