Incidental Mutation 'R6510:Msh3'
ID519890
Institutional Source Beutler Lab
Gene Symbol Msh3
Ensembl Gene ENSMUSG00000014850
Gene NamemutS homolog 3
SynonymsRep3, Rep-3, D13Em1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.429) question?
Stock #R6510 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location92211872-92355003 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 92353264 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 73 (K73*)
Ref Sequence ENSEMBL: ENSMUSP00000140659 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022218] [ENSMUST00000022220] [ENSMUST00000185852] [ENSMUST00000187424] [ENSMUST00000187874] [ENSMUST00000190393] [ENSMUST00000191509] [ENSMUST00000191550]
Predicted Effect probably benign
Transcript: ENSMUST00000022218
SMART Domains Protein: ENSMUSP00000022218
Gene: ENSMUSG00000021707

DomainStartEndE-ValueType
Pfam:DHFR_1 4 185 3.9e-37 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000022220
AA Change: K73*
SMART Domains Protein: ENSMUSP00000022220
Gene: ENSMUSG00000014850
AA Change: K73*

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Pfam:MutS_I 188 301 1.6e-35 PFAM
Pfam:MutS_II 324 481 2.2e-36 PFAM
MUTSd 513 828 7.62e-97 SMART
MUTSac 847 1049 9.7e-122 SMART
Predicted Effect probably null
Transcript: ENSMUST00000185852
AA Change: K73*
SMART Domains Protein: ENSMUSP00000140002
Gene: ENSMUSG00000014850
AA Change: K73*

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Pfam:MutS_I 188 301 7.2e-35 PFAM
Pfam:MutS_II 324 481 2.2e-36 PFAM
MUTSd 513 828 7.62e-97 SMART
MUTSac 847 1049 9.7e-122 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186878
Predicted Effect probably null
Transcript: ENSMUST00000187424
AA Change: K73*
SMART Domains Protein: ENSMUSP00000139622
Gene: ENSMUSG00000014850
AA Change: K73*

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187831
Predicted Effect probably null
Transcript: ENSMUST00000187874
AA Change: K73*
SMART Domains Protein: ENSMUSP00000139620
Gene: ENSMUSG00000014850
AA Change: K73*

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000190393
AA Change: K73*
SMART Domains Protein: ENSMUSP00000141163
Gene: ENSMUSG00000014850
AA Change: K73*

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Pfam:MutS_I 188 241 6.4e-10 PFAM
low complexity region 261 285 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000191509
SMART Domains Protein: ENSMUSP00000141158
Gene: ENSMUSG00000014850

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000191550
AA Change: K73*
SMART Domains Protein: ENSMUSP00000140659
Gene: ENSMUSG00000014850
AA Change: K73*

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene forms a heterodimer with MSH2 to form MutS beta, part of the post-replicative DNA mismatch repair system. MutS beta initiates mismatch repair by binding to a mismatch and then forming a complex with MutL alpha heterodimer. This gene contains a polymorphic 9 bp tandem repeat sequence in the first exon. The repeat is present 6 times in the reference genome sequence and 3-7 repeats have been reported. Defects in this gene are a cause of susceptibility to endometrial cancer. [provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a partial defect mismatch repair and development of intestinal tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 G A 19: 43,782,206 probably null Het
Adgrv1 T C 13: 81,559,490 T1266A possibly damaging Het
Arhgef17 T C 7: 100,878,536 N1758S probably damaging Het
C130073F10Rik T A 4: 101,890,285 E182D probably benign Het
Ears2 T C 7: 122,062,994 D77G probably damaging Het
Ephb3 A G 16: 21,218,111 D108G probably damaging Het
Foxp4 A G 17: 47,875,410 F452S unknown Het
Gas2 T C 7: 51,943,712 L180P probably damaging Het
Gm28168 T C 1: 117,947,955 Y105H probably damaging Het
Ifi205 T A 1: 174,017,565 D217V probably damaging Het
Igsf9 C G 1: 172,490,297 Q74E possibly damaging Het
Itga2 A T 13: 114,873,280 F380I probably damaging Het
Kremen2 A G 17: 23,743,655 V128A possibly damaging Het
Mmp20 T A 9: 7,643,966 N218K probably damaging Het
Olfr1195 C T 2: 88,682,958 R258H probably benign Het
Pate2 T A 9: 35,669,722 C8S probably null Het
Prkag2 G T 5: 25,100,288 probably benign Het
Serpini2 T C 3: 75,252,568 D297G probably damaging Het
Sgca A T 11: 94,963,232 L137Q probably benign Het
Treml4 A G 17: 48,274,444 D249G probably benign Het
Vmn1r226 T C 17: 20,687,853 C116R probably benign Het
Other mutations in Msh3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00895:Msh3 APN 13 92344964 missense probably damaging 1.00
IGL00983:Msh3 APN 13 92300277 missense probably damaging 1.00
IGL01490:Msh3 APN 13 92300305 missense probably damaging 1.00
IGL02072:Msh3 APN 13 92300295 missense probably damaging 1.00
IGL02313:Msh3 APN 13 92349312 missense possibly damaging 0.87
IGL02711:Msh3 APN 13 92351311 missense probably damaging 1.00
IGL03108:Msh3 APN 13 92221088 splice site probably benign
IGL03227:Msh3 APN 13 92285960 missense probably damaging 0.98
R0164:Msh3 UTSW 13 92349209 missense probably damaging 1.00
R0164:Msh3 UTSW 13 92349209 missense probably damaging 1.00
R0415:Msh3 UTSW 13 92346786 missense possibly damaging 0.89
R0457:Msh3 UTSW 13 92220997 missense probably damaging 1.00
R0659:Msh3 UTSW 13 92345096 missense possibly damaging 0.80
R0661:Msh3 UTSW 13 92345096 missense possibly damaging 0.80
R0686:Msh3 UTSW 13 92351431 missense possibly damaging 0.53
R0688:Msh3 UTSW 13 92351431 missense possibly damaging 0.53
R0707:Msh3 UTSW 13 92347340 nonsense probably null
R1605:Msh3 UTSW 13 92300275 missense probably null 1.00
R1622:Msh3 UTSW 13 92344954 critical splice donor site probably null
R1771:Msh3 UTSW 13 92212496 missense probably benign 0.05
R1970:Msh3 UTSW 13 92249820 splice site probably benign
R1971:Msh3 UTSW 13 92223276 missense probably damaging 1.00
R1971:Msh3 UTSW 13 92249820 splice site probably benign
R2894:Msh3 UTSW 13 92342360 missense probably benign 0.16
R3837:Msh3 UTSW 13 92354858 missense probably damaging 1.00
R4119:Msh3 UTSW 13 92354011 intron probably benign
R4225:Msh3 UTSW 13 92285923 missense probably benign 0.03
R4881:Msh3 UTSW 13 92266041 intron probably benign
R5118:Msh3 UTSW 13 92309434 splice site probably benign
R5209:Msh3 UTSW 13 92344954 critical splice donor site probably null
R5817:Msh3 UTSW 13 92286000 missense possibly damaging 0.86
R5849:Msh3 UTSW 13 92249878 missense possibly damaging 0.81
R5851:Msh3 UTSW 13 92215522 missense probably benign 0.00
R5940:Msh3 UTSW 13 92249843 missense probably damaging 1.00
R6004:Msh3 UTSW 13 92342414 critical splice acceptor site probably null
R6363:Msh3 UTSW 13 92212524 missense probably damaging 1.00
R6654:Msh3 UTSW 13 92345042 missense probably benign 0.01
R6853:Msh3 UTSW 13 92312572 critical splice donor site probably null
S24628:Msh3 UTSW 13 92346786 missense possibly damaging 0.89
X0027:Msh3 UTSW 13 92274070 missense probably damaging 0.98
X0063:Msh3 UTSW 13 92274785 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACTAAGAGAACTGAGCTCCTCTG -3'
(R):5'- CCCCAACAGCCTTTTCAGAG -3'

Sequencing Primer
(F):5'- AACTGAGCTCCTCTGTGGGC -3'
(R):5'- GGCAGGCAGGAACTTACTATCATTC -3'
Posted On2018-06-06