Incidental Mutation 'R6510:Kremen2'
ID 519894
Institutional Source Beutler Lab
Gene Symbol Kremen2
Ensembl Gene ENSMUSG00000040680
Gene Name kringle containing transmembrane protein 2
Synonyms Krm2, 2900054E04Rik
MMRRC Submission 044423-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.066) question?
Stock # R6510 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 23960171-23964807 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 23962629 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 128 (V128A)
Ref Sequence ENSEMBL: ENSMUSP00000046369 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024702] [ENSMUST00000046525]
AlphaFold Q8K1S7
Predicted Effect probably benign
Transcript: ENSMUST00000024702
SMART Domains Protein: ENSMUSP00000024702
Gene: ENSMUSG00000023909

DomainStartEndE-ValueType
Pfam:HlyIII 43 254 1e-26 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000046525
AA Change: V128A

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000046369
Gene: ENSMUSG00000040680
AA Change: V128A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
KR 33 120 2.44e-18 SMART
Pfam:WSC 123 204 1.3e-20 PFAM
CUB 218 325 8.04e-15 SMART
Blast:CUB 351 422 8e-6 BLAST
low complexity region 446 461 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181291
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a high-affinity dickkopf homolog 1 (DKK1) transmembrane receptor. A similar protein in mouse functions interacts with with DKK1 to block wingless (WNT)/beta-catenin signaling. The encoded protein forms a ternary membrane complex with DKK1 and the WNT receptor lipoprotein receptor-related protein 6 (LRP6), and induces rapid endocytosis and removal of LRP6 from the plasma membrane. It contains extracellular kringle, WSC, and CUB domains. Alternatively spliced transcript variants encoding distinct isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit no abnormal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 G A 19: 43,770,645 (GRCm39) probably null Het
Adgrv1 T C 13: 81,707,609 (GRCm39) T1266A possibly damaging Het
Arhgef17 T C 7: 100,527,743 (GRCm39) N1758S probably damaging Het
C130073F10Rik T A 4: 101,747,482 (GRCm39) E182D probably benign Het
Ears2 T C 7: 121,662,217 (GRCm39) D77G probably damaging Het
Ephb3 A G 16: 21,036,861 (GRCm39) D108G probably damaging Het
Foxp4 A G 17: 48,186,335 (GRCm39) F452S unknown Het
Gas2 T C 7: 51,593,460 (GRCm39) L180P probably damaging Het
Gm28168 T C 1: 117,875,685 (GRCm39) Y105H probably damaging Het
Ifi205 T A 1: 173,845,131 (GRCm39) D217V probably damaging Het
Igsf9 C G 1: 172,317,864 (GRCm39) Q74E possibly damaging Het
Itga2 A T 13: 115,009,816 (GRCm39) F380I probably damaging Het
Mmp20 T A 9: 7,643,967 (GRCm39) N218K probably damaging Het
Msh3 T A 13: 92,489,772 (GRCm39) K73* probably null Het
Or4c103 C T 2: 88,513,302 (GRCm39) R258H probably benign Het
Pate2 T A 9: 35,581,018 (GRCm39) C11S probably null Het
Prkag2 G T 5: 25,305,286 (GRCm39) probably benign Het
Serpini2 T C 3: 75,159,875 (GRCm39) D297G probably damaging Het
Sgca A T 11: 94,854,058 (GRCm39) L137Q probably benign Het
Treml4 A G 17: 48,581,472 (GRCm39) D249G probably benign Het
Vmn1r226 T C 17: 20,908,115 (GRCm39) C116R probably benign Het
Other mutations in Kremen2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02327:Kremen2 APN 17 23,962,543 (GRCm39) missense probably benign 0.11
R0057:Kremen2 UTSW 17 23,962,202 (GRCm39) missense possibly damaging 0.94
R0369:Kremen2 UTSW 17 23,961,784 (GRCm39) missense probably benign 0.02
R0835:Kremen2 UTSW 17 23,961,811 (GRCm39) missense probably damaging 0.99
R0847:Kremen2 UTSW 17 23,963,634 (GRCm39) missense probably damaging 1.00
R1733:Kremen2 UTSW 17 23,962,373 (GRCm39) splice site probably null
R2056:Kremen2 UTSW 17 23,961,691 (GRCm39) missense possibly damaging 0.94
R2057:Kremen2 UTSW 17 23,961,691 (GRCm39) missense possibly damaging 0.94
R2058:Kremen2 UTSW 17 23,961,691 (GRCm39) missense possibly damaging 0.94
R2173:Kremen2 UTSW 17 23,961,770 (GRCm39) missense probably damaging 0.98
R5553:Kremen2 UTSW 17 23,960,776 (GRCm39) unclassified probably benign
R5583:Kremen2 UTSW 17 23,961,229 (GRCm39) missense probably benign 0.00
R6057:Kremen2 UTSW 17 23,961,679 (GRCm39) missense probably benign 0.00
R7068:Kremen2 UTSW 17 23,960,859 (GRCm39) missense possibly damaging 0.87
R7227:Kremen2 UTSW 17 23,963,573 (GRCm39) nonsense probably null
R7382:Kremen2 UTSW 17 23,962,526 (GRCm39) splice site probably null
R8113:Kremen2 UTSW 17 23,962,776 (GRCm39) missense probably damaging 1.00
R8167:Kremen2 UTSW 17 23,962,314 (GRCm39) missense probably damaging 1.00
R8328:Kremen2 UTSW 17 23,961,745 (GRCm39) missense probably benign
R8544:Kremen2 UTSW 17 23,961,201 (GRCm39) missense probably benign 0.00
R8726:Kremen2 UTSW 17 23,961,720 (GRCm39) missense probably damaging 1.00
R9017:Kremen2 UTSW 17 23,964,737 (GRCm39) start gained probably benign
R9064:Kremen2 UTSW 17 23,961,736 (GRCm39) missense possibly damaging 0.76
R9216:Kremen2 UTSW 17 23,962,781 (GRCm39) missense probably damaging 1.00
R9333:Kremen2 UTSW 17 23,962,775 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGAAGTTAGTGTCAAGTTTGGC -3'
(R):5'- TATCTCCCTCCGGACCACAG -3'

Sequencing Primer
(F):5'- AAGTTAGTGTCAAGTTTGGCATTTG -3'
(R):5'- ACCCAGACGGTGATGTGCAG -3'
Posted On 2018-06-06