Incidental Mutation 'R6512:Asic4'
ID519938
Institutional Source Beutler Lab
Gene Symbol Asic4
Ensembl Gene ENSMUSG00000033007
Gene Nameacid-sensing (proton-gated) ion channel family member 4
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6512 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location75450436-75474343 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 75473043 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 439 (L439*)
Ref Sequence ENSEMBL: ENSMUSP00000109207 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037708] [ENSMUST00000079205] [ENSMUST00000094818] [ENSMUST00000113577] [ENSMUST00000124042] [ENSMUST00000138683]
Predicted Effect probably null
Transcript: ENSMUST00000037708
AA Change: L458*
SMART Domains Protein: ENSMUSP00000045598
Gene: ENSMUSG00000033007
AA Change: L458*

DomainStartEndE-ValueType
low complexity region 12 26 N/A INTRINSIC
Pfam:ASC 45 464 5.3e-92 PFAM
low complexity region 507 533 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000079205
SMART Domains Protein: ENSMUSP00000078199
Gene: ENSMUSG00000032997

DomainStartEndE-ValueType
low complexity region 37 46 N/A INTRINSIC
Pfam:CHGN 262 761 5e-150 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000094818
SMART Domains Protein: ENSMUSP00000092412
Gene: ENSMUSG00000032997

DomainStartEndE-ValueType
Pfam:CHGN 100 599 3.3e-174 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000113577
AA Change: L439*
SMART Domains Protein: ENSMUSP00000109207
Gene: ENSMUSG00000033007
AA Change: L439*

DomainStartEndE-ValueType
low complexity region 12 26 N/A INTRINSIC
Pfam:ASC 45 346 5.5e-94 PFAM
Pfam:ASC 344 446 1.4e-42 PFAM
low complexity region 488 514 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124042
SMART Domains Protein: ENSMUSP00000122057
Gene: ENSMUSG00000032997

DomainStartEndE-ValueType
low complexity region 37 46 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138683
SMART Domains Protein: ENSMUSP00000117253
Gene: ENSMUSG00000032997

DomainStartEndE-ValueType
low complexity region 37 46 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143496
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194916
Meta Mutation Damage Score 0.59 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 93.9%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the superfamily of acid-sensing ion channels, which are proton-gated, amiloride-sensitive sodium channels. These channels have been implicated in synaptic transmission, pain perception as well as mechanoperception. This gene is predominantly expressed in the pituitary gland, and was considered a candidate for paroxysmal dystonic choreoathetosis (PDC), a movement disorder, however, no correlation was found between mutations in this gene and PDC. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous knockout increases the fear response in the predator-odor induced fear test and increases anxiety in open field and elevated plus maze tests. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700122O11Rik A G 17: 48,036,863 S211P possibly damaging Het
Abcb11 T C 2: 69,282,652 T674A probably benign Het
Acad11 G T 9: 104,095,559 E484* probably null Het
Ankhd1 A T 18: 36,591,456 D389V probably damaging Het
Atp13a2 A G 4: 141,003,218 T808A probably damaging Het
Capn13 C A 17: 73,382,990 V9L probably benign Het
Chst11 A G 10: 83,191,468 Y243C probably damaging Het
Ctdp1 A T 18: 80,451,263 W308R probably damaging Het
Dnttip2 A G 3: 122,275,523 E129G possibly damaging Het
Dock5 A G 14: 67,824,648 S424P possibly damaging Het
Ebf1 C T 11: 44,992,341 H469Y probably damaging Het
Efhc1 A T 1: 20,960,349 N169Y probably damaging Het
Elmo1 T C 13: 20,373,161 L424P probably damaging Het
Ighv1-59 A G 12: 115,335,383 V16A probably damaging Het
Kcnc1 T G 7: 46,427,397 C208G probably damaging Het
Kif13b A T 14: 64,744,874 probably null Het
Lilra6 T A 7: 3,914,388 N203Y probably benign Het
Mkl1 T C 15: 81,013,716 T787A probably benign Het
Myh8 A T 11: 67,289,662 K575* probably null Het
Nedd1 C T 10: 92,691,875 A486T probably benign Het
Olfr170 A T 16: 19,606,359 L103H probably damaging Het
Phrf1 T C 7: 141,260,396 I1168T possibly damaging Het
Pla2g12a T A 3: 129,888,957 H59Q probably benign Het
Ralbp1 A G 17: 65,861,275 V345A probably damaging Het
Ryr3 C T 2: 112,867,378 V894M possibly damaging Het
Sec24b T A 3: 130,041,297 Y84F probably damaging Het
Slc22a26 T C 19: 7,802,500 probably benign Het
Smc1b C T 15: 85,092,031 R825Q probably benign Het
Spats1 C T 17: 45,452,673 probably null Het
Tbk1 T A 10: 121,578,621 N63Y probably damaging Het
Tbl1xr1 C T 3: 22,140,534 probably benign Het
Top2b T A 14: 16,409,854 D840E possibly damaging Het
Trpc3 T A 3: 36,662,758 Y377F possibly damaging Het
Uba6 C T 5: 86,124,403 R778K probably benign Het
Vmn2r101 A T 17: 19,588,884 I92F probably damaging Het
Vmn2r106 C T 17: 20,268,463 C558Y probably damaging Het
Vmn2r70 G T 7: 85,566,097 F76L probably benign Het
Vwa3b A G 1: 37,063,642 probably benign Het
Zfp407 T A 18: 84,560,349 T880S probably damaging Het
Zfp64 C A 2: 168,894,077 G560V probably benign Het
Other mutations in Asic4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01399:Asic4 APN 1 75469146 missense possibly damaging 0.94
IGL01470:Asic4 APN 1 75450866 missense probably damaging 1.00
IGL02645:Asic4 APN 1 75473354 unclassified probably benign
IGL03002:Asic4 APN 1 75451323 missense possibly damaging 0.61
positron UTSW 1 75473043 nonsense probably null
PIT4445001:Asic4 UTSW 1 75451127 missense probably benign 0.03
R0106:Asic4 UTSW 1 75451127 missense probably benign 0.03
R0138:Asic4 UTSW 1 75469687 missense possibly damaging 0.87
R0453:Asic4 UTSW 1 75473511 unclassified probably benign
R0573:Asic4 UTSW 1 75469102 splice site probably benign
R0705:Asic4 UTSW 1 75451370 missense probably damaging 1.00
R1892:Asic4 UTSW 1 75469482 missense probably damaging 1.00
R1912:Asic4 UTSW 1 75469232 missense possibly damaging 0.93
R3614:Asic4 UTSW 1 75473058 missense probably damaging 1.00
R3790:Asic4 UTSW 1 75469841 unclassified probably benign
R3923:Asic4 UTSW 1 75451227 missense probably damaging 1.00
R4447:Asic4 UTSW 1 75470370 unclassified probably benign
R5177:Asic4 UTSW 1 75450839 missense probably damaging 1.00
R5208:Asic4 UTSW 1 75451226 missense probably damaging 1.00
R5266:Asic4 UTSW 1 75450923 missense probably benign 0.03
R5436:Asic4 UTSW 1 75451319 missense probably benign 0.09
R5921:Asic4 UTSW 1 75451373 missense probably benign 0.30
R6086:Asic4 UTSW 1 75473243 missense possibly damaging 0.64
R6530:Asic4 UTSW 1 75472335 missense probably damaging 0.98
R7545:Asic4 UTSW 1 75472416 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CAGGGAGAACTTCTTGGTCC -3'
(R):5'- AAGAGGCCTCACTTATAGGACTTG -3'

Sequencing Primer
(F):5'- GCCCTAACTTCTGAAGCCATGG -3'
(R):5'- AGGACTTGTTGCCTACCAAG -3'
Posted On2018-06-06