Incidental Mutation 'R6513:Dsg1c'
ID520038
Institutional Source Beutler Lab
Gene Symbol Dsg1c
Ensembl Gene ENSMUSG00000034774
Gene Namedesmoglein 1 gamma
SynonymsDsg6
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6513 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location20247340-20285031 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 20274630 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 344 (N344K)
Ref Sequence ENSEMBL: ENSMUSP00000054799 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054128]
Predicted Effect probably benign
Transcript: ENSMUST00000054128
AA Change: N344K

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000054799
Gene: ENSMUSG00000034774
AA Change: N344K

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 70 155 1.7e-16 SMART
CA 179 267 5.2e-24 SMART
CA 290 384 4.5e-8 SMART
Blast:CA 407 488 8e-28 BLAST
low complexity region 491 500 N/A INTRINSIC
low complexity region 528 539 N/A INTRINSIC
low complexity region 545 553 N/A INTRINSIC
Pfam:Cadherin_C 611 732 5.2e-8 PFAM
low complexity region 737 750 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.4%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of proteins that forms an integral transmembrane component of desmosomes, the multiprotein complexes involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438H23Rik T C 16: 91,055,766 S161G probably benign Het
Ankfy1 G A 11: 72,730,482 R198Q possibly damaging Het
Ankrd11 A G 8: 122,890,180 V2290A probably benign Het
Aox4 A G 1: 58,213,053 N29S probably benign Het
Arhgap17 T C 7: 123,292,156 R592G possibly damaging Het
BC027072 T A 17: 71,744,706 E1217V probably damaging Het
C87414 C A 5: 93,637,532 probably null Het
Caap1 A T 4: 94,501,403 D231E possibly damaging Het
Cabp1 T A 5: 115,169,134 M165L possibly damaging Het
Cep72 A T 13: 74,058,463 L73H probably damaging Het
Cfap74 A G 4: 155,441,286 S731G probably null Het
Dsc2 T C 18: 20,046,238 I258V probably benign Het
Enah A G 1: 182,014,355 probably benign Het
Fam26d T A 10: 34,041,634 R274* probably null Het
Fbn1 T A 2: 125,383,671 S554C probably damaging Het
Fkrp C A 7: 16,811,112 R275L possibly damaging Het
Gbp4 C T 5: 105,123,120 G215D possibly damaging Het
Gli2 G A 1: 118,855,554 L239F probably damaging Het
Gpr146 A G 5: 139,392,818 D125G probably damaging Het
Hectd4 C A 5: 121,356,196 probably null Het
Invs G A 4: 48,397,534 V370I possibly damaging Het
Kdm2b A G 5: 122,880,239 V1040A probably damaging Het
Kidins220 T A 12: 25,038,435 V1059D possibly damaging Het
Kif1bp T C 10: 62,575,034 probably null Het
Kif26a T A 12: 112,175,492 S727T probably damaging Het
Klk1b27 A G 7: 44,055,745 H112R probably benign Het
Krt72 T G 15: 101,776,752 probably null Het
Lactb C T 9: 66,970,890 R219H probably damaging Het
Lrig2 A T 3: 104,465,729 I612N probably damaging Het
Meaf6 A C 4: 125,089,904 N51T probably damaging Het
Mtap A G 4: 89,148,261 T36A possibly damaging Het
Myo3a G A 2: 22,407,332 G713S probably damaging Het
Nr4a3 C T 4: 48,083,255 T596I probably damaging Het
Olfr1306 C G 2: 111,912,883 G16R possibly damaging Het
Olfr1338 A T 4: 118,754,027 C172* probably null Het
Pam A G 1: 97,838,027 V759A possibly damaging Het
Pds5a T A 5: 65,615,601 I1220F probably benign Het
Phldb2 T A 16: 45,747,877 M1222L possibly damaging Het
Phospho1 C T 11: 95,830,687 A61V possibly damaging Het
Pnpla7 G A 2: 25,016,538 V638I possibly damaging Het
Ptf1a T A 2: 19,447,037 D282E probably damaging Het
Ptgs2 A T 1: 150,100,128 probably benign Het
Racgap1 T C 15: 99,624,275 R471G probably damaging Het
Rptn T C 3: 93,396,112 S251P possibly damaging Het
Shcbp1 T C 8: 4,744,507 M429V probably benign Het
Shprh T C 10: 11,186,893 L1248P probably damaging Het
Son T C 16: 91,659,947 probably benign Het
Sppl3 T C 5: 115,095,936 L355P probably damaging Het
Tbc1d31 A T 15: 57,955,382 R794W probably damaging Het
Telo2 T C 17: 25,101,412 Y766C probably damaging Het
Tfr2 A G 5: 137,574,531 probably null Het
Tle4 T C 19: 14,451,692 D722G probably damaging Het
Tprgl A G 4: 154,159,405 V98A probably benign Het
Trak1 C T 9: 121,443,756 R237C probably benign Het
Vmn2r113 T C 17: 22,958,741 I833T probably damaging Het
Vmn2r118 T A 17: 55,608,093 S518C probably damaging Het
Vmn2r49 A G 7: 9,976,597 I736T probably damaging Het
Wdr38 T A 2: 38,999,958 probably null Het
Wee2 A G 6: 40,452,619 E180G probably benign Het
Zbtb1 T C 12: 76,385,830 S197P possibly damaging Het
Zc3h7a T C 16: 11,158,765 probably null Het
Zfp516 T A 18: 82,955,710 L11Q probably damaging Het
Zfp623 G A 15: 75,947,468 R91H probably benign Het
Zkscan7 G A 9: 122,896,105 R713Q probably benign Het
Other mutations in Dsg1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00567:Dsg1c APN 18 20274676 missense probably damaging 1.00
IGL00596:Dsg1c APN 18 20281842 splice site probably benign
IGL01412:Dsg1c APN 18 20247461 missense probably benign
IGL02037:Dsg1c APN 18 20276950 missense probably benign 0.02
IGL02247:Dsg1c APN 18 20264316 missense probably damaging 1.00
IGL02386:Dsg1c APN 18 20276999 missense probably benign
IGL02408:Dsg1c APN 18 20274719 missense probably damaging 1.00
IGL02519:Dsg1c APN 18 20283733 missense probably damaging 1.00
IGL02591:Dsg1c APN 18 20275192 missense probably damaging 1.00
IGL02730:Dsg1c APN 18 20274830 missense probably damaging 1.00
IGL02836:Dsg1c APN 18 20267929 missense probably benign 0.07
IGL03335:Dsg1c APN 18 20283697 missense probably benign 0.01
R0385:Dsg1c UTSW 18 20283654 missense probably damaging 1.00
R0561:Dsg1c UTSW 18 20274775 missense probably benign 0.04
R0570:Dsg1c UTSW 18 20270378 missense probably damaging 1.00
R0573:Dsg1c UTSW 18 20279241 missense probably benign 0.02
R0621:Dsg1c UTSW 18 20279695 missense possibly damaging 0.62
R0632:Dsg1c UTSW 18 20272346 splice site probably benign
R1183:Dsg1c UTSW 18 20283198 missense probably damaging 1.00
R1529:Dsg1c UTSW 18 20282023 missense probably damaging 1.00
R1596:Dsg1c UTSW 18 20282047 missense probably damaging 1.00
R1619:Dsg1c UTSW 18 20264842 missense probably benign 0.36
R1623:Dsg1c UTSW 18 20275177 missense probably damaging 1.00
R1844:Dsg1c UTSW 18 20283039 splice site probably null
R1881:Dsg1c UTSW 18 20272540 splice site probably benign
R2017:Dsg1c UTSW 18 20266196 missense possibly damaging 0.67
R2072:Dsg1c UTSW 18 20275252 missense probably benign 0.09
R2319:Dsg1c UTSW 18 20275178 missense probably damaging 1.00
R2340:Dsg1c UTSW 18 20267888 missense probably damaging 1.00
R3403:Dsg1c UTSW 18 20270350 missense probably damaging 1.00
R3407:Dsg1c UTSW 18 20282058 critical splice donor site probably null
R3874:Dsg1c UTSW 18 20277052 missense probably benign 0.02
R3910:Dsg1c UTSW 18 20266196 missense possibly damaging 0.67
R4535:Dsg1c UTSW 18 20275265 missense probably benign 0.01
R4739:Dsg1c UTSW 18 20275189 missense possibly damaging 0.95
R5038:Dsg1c UTSW 18 20264844 missense probably benign 0.00
R5165:Dsg1c UTSW 18 20277023 missense probably damaging 1.00
R5210:Dsg1c UTSW 18 20274701 missense probably damaging 0.97
R5253:Dsg1c UTSW 18 20272379 missense probably damaging 1.00
R5327:Dsg1c UTSW 18 20267937 missense possibly damaging 0.75
R5361:Dsg1c UTSW 18 20283646 missense possibly damaging 0.94
R5475:Dsg1c UTSW 18 20282031 missense probably damaging 0.99
R5512:Dsg1c UTSW 18 20272511 missense probably damaging 1.00
R5681:Dsg1c UTSW 18 20283213 missense probably damaging 1.00
R5710:Dsg1c UTSW 18 20272351 missense probably benign 0.06
R5889:Dsg1c UTSW 18 20283601 missense possibly damaging 0.87
R6596:Dsg1c UTSW 18 20270524 intron probably null
R6941:Dsg1c UTSW 18 20267923 missense probably damaging 0.96
R7041:Dsg1c UTSW 18 20266144 missense probably damaging 1.00
R7061:Dsg1c UTSW 18 20277009 missense probably benign
R7240:Dsg1c UTSW 18 20283109 missense probably damaging 1.00
X0026:Dsg1c UTSW 18 20283258 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTCCCAGCAAGTAAGACTGG -3'
(R):5'- ACCTGTTTCACAGTCTGTAGC -3'

Sequencing Primer
(F):5'- CTGGACCGGGTAATCACATG -3'
(R):5'- GTAGCTAAAAACTCTCCCACTGTGTG -3'
Posted On2018-06-06