Incidental Mutation 'R6347:1700021F07Rik'
List |< first << previous [record 67 of 18188] next >> last >|
ID520049
Institutional Source Beutler Lab
Gene Symbol 1700021F07Rik
Ensembl Gene ENSMUSG00000027518
Gene NameRIKEN cDNA 1700021F07 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.043) question?
Stock #R6347 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location173522586-173528501 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 173527915 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 74 (R74L)
Ref Sequence ENSEMBL: ENSMUSP00000029023 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029023]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029023
AA Change: R74L

PolyPhen 2 Score 0.775 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000029023
Gene: ENSMUSG00000027518
AA Change: R74L

DomainStartEndE-ValueType
Pfam:LLC1 16 134 2.1e-51 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.6%
  • 20x: 92.3%
Validation Efficiency 95% (41/43)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atat1 A G 17: 35,910,029 F3L probably damaging Het
Atf7 T A 15: 102,546,479 M285L possibly damaging Het
Bcl7b T C 5: 135,180,533 S95P possibly damaging Het
Cald1 A C 6: 34,765,046 K453Q probably damaging Het
Cog4 A T 8: 110,880,643 I580F probably damaging Het
Cpq T A 15: 33,290,186 probably null Het
Csf2rb G A 15: 78,345,552 D440N probably damaging Het
Dst A G 1: 34,179,684 probably null Het
Eif2b3 T C 4: 117,044,566 V142A probably benign Het
Fat3 A T 9: 15,998,372 N2111K probably damaging Het
Fbxo31 C A 8: 121,578,459 E99D possibly damaging Het
Fgfr2 T C 7: 130,261,757 E34G probably damaging Het
Flvcr2 T C 12: 85,747,420 V190A possibly damaging Het
Herc2 T C 7: 56,194,403 probably null Het
Igkv3-2 A C 6: 70,699,033 M109L probably benign Het
Il1f5 G A 2: 24,279,714 A29T probably damaging Het
Kif13b C T 14: 64,767,619 T1120I probably benign Het
Kmt2c A G 5: 25,310,835 I2670T possibly damaging Het
Lcp2 A G 11: 34,082,501 M360V probably benign Het
Ldlrad4 A G 18: 68,235,780 S103G probably benign Het
Loxl4 T C 19: 42,608,270 K88E probably damaging Het
Ltbp2 C A 12: 84,853,912 R192L probably damaging Het
Mast2 C A 4: 116,317,732 G475V probably damaging Het
Meis1 A C 11: 18,905,631 probably null Het
Mroh3 T C 1: 136,200,937 probably null Het
Myo5b C T 18: 74,770,385 A1824V probably benign Het
Nectin3 C T 16: 46,458,124 V303M probably benign Het
Olfr472 T C 7: 107,902,950 S78P possibly damaging Het
Peak1 T C 9: 56,258,211 N811S probably benign Het
Pik3ca C T 3: 32,462,821 A1066V probably benign Het
Rnf103 A G 6: 71,505,824 T153A possibly damaging Het
Sacs G A 14: 61,211,160 V3552I probably damaging Het
Sgca A T 11: 94,972,028 N109K probably damaging Het
Speg T A 1: 75,426,875 M2621K probably benign Het
Stfa2l1 T C 16: 36,156,901 I22T probably damaging Het
Tbpl2 G A 2: 24,094,703 P144L probably benign Het
Tmem219 T C 7: 126,896,826 N119S possibly damaging Het
Ush2a A G 1: 188,910,887 T4149A probably benign Het
Wdr46 C A 17: 33,941,852 P197T probably damaging Het
Wee2 C T 6: 40,455,105 R203C probably damaging Het
Other mutations in 1700021F07Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02375:1700021F07Rik APN 2 173522703 missense probably benign 0.34
R0376:1700021F07Rik UTSW 2 173528327 missense probably benign 0.00
R0925:1700021F07Rik UTSW 2 173526074 missense probably benign 0.01
R1102:1700021F07Rik UTSW 2 173522723 missense probably damaging 1.00
R1319:1700021F07Rik UTSW 2 173527923 missense probably damaging 0.98
R3430:1700021F07Rik UTSW 2 173528273 missense possibly damaging 0.60
R4006:1700021F07Rik UTSW 2 173526087 critical splice donor site probably null
R5663:1700021F07Rik UTSW 2 173527897 missense probably damaging 1.00
R6362:1700021F07Rik UTSW 2 173528174 splice site probably null
R6452:1700021F07Rik UTSW 2 173527907 missense probably benign 0.15
R6453:1700021F07Rik UTSW 2 173528259 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- GGCTAACTCCGCAACTCAGATC -3'
(R):5'- TGTCATTGTAGGGCAAATGGC -3'

Sequencing Primer
(F):5'- AGGAGCACCTCTGCATGG -3'
(R):5'- CCACACATGCCACAGGGTG -3'
Posted On2018-06-06