Incidental Mutation 'R6347:Sgca'
ID520068
Institutional Source Beutler Lab
Gene Symbol Sgca
Ensembl Gene ENSMUSG00000001508
Gene Namesarcoglycan, alpha (dystrophin-associated glycoprotein)
Synonyms50DAG, adhalin, Asg
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.410) question?
Stock #R6347 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location94962791-94976327 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 94972028 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 109 (N109K)
Ref Sequence ENSEMBL: ENSMUSP00000130617 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038928] [ENSMUST00000100551] [ENSMUST00000103162] [ENSMUST00000139855] [ENSMUST00000152042] [ENSMUST00000166320]
Predicted Effect probably benign
Transcript: ENSMUST00000038928
SMART Domains Protein: ENSMUSP00000039866
Gene: ENSMUSG00000038994

DomainStartEndE-ValueType
Pfam:Linker_histone 35 106 5.9e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000100551
AA Change: N109K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000098118
Gene: ENSMUSG00000001508
AA Change: N109K

DomainStartEndE-ValueType
CADG 27 131 2.14e-10 SMART
low complexity region 287 309 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000103162
AA Change: N109K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099451
Gene: ENSMUSG00000001508
AA Change: N109K

DomainStartEndE-ValueType
CADG 27 131 2.14e-10 SMART
low complexity region 287 309 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139855
SMART Domains Protein: ENSMUSP00000117637
Gene: ENSMUSG00000001508

DomainStartEndE-ValueType
Pfam:Sarcoglycan_2 1 140 2.1e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152042
SMART Domains Protein: ENSMUSP00000118455
Gene: ENSMUSG00000001508

DomainStartEndE-ValueType
Pfam:Sarcoglycan_2 6 100 5.9e-34 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000166320
AA Change: N109K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130617
Gene: ENSMUSG00000001508
AA Change: N109K

DomainStartEndE-ValueType
CADG 27 131 2.14e-10 SMART
low complexity region 287 309 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.6%
  • 20x: 92.3%
Validation Efficiency 95% (41/43)
MGI Phenotype FUNCTION: This gene encodes a member of the sarcoglycan alpha/epsilon family of transmembrane proteins. The encoded protein is part of the dystrophin-glycoprotein complex which links the extracellular matrix to the cytoskeleton in muscle fibers. Disruption of this gene results in progressive muscular dystrophy and is associated with the development of embryonal rhabdomysarcoma. [provided by RefSeq, Dec 2012]
PHENOTYPE: Homozygous mutation of this gene results in muscle abnormalities, with decreased skeletal muscle force and stiffness and muscular dystrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F07Rik G T 2: 173,527,915 R74L possibly damaging Het
Atat1 A G 17: 35,910,029 F3L probably damaging Het
Atf7 T A 15: 102,546,479 M285L possibly damaging Het
Bcl7b T C 5: 135,180,533 S95P possibly damaging Het
Cald1 A C 6: 34,765,046 K453Q probably damaging Het
Cog4 A T 8: 110,880,643 I580F probably damaging Het
Cpq T A 15: 33,290,186 probably null Het
Csf2rb G A 15: 78,345,552 D440N probably damaging Het
Dst A G 1: 34,179,684 probably null Het
Eif2b3 T C 4: 117,044,566 V142A probably benign Het
Fat3 A T 9: 15,998,372 N2111K probably damaging Het
Fbxo31 C A 8: 121,578,459 E99D possibly damaging Het
Fgfr2 T C 7: 130,261,757 E34G probably damaging Het
Flvcr2 T C 12: 85,747,420 V190A possibly damaging Het
Herc2 T C 7: 56,194,403 probably null Het
Igkv3-2 A C 6: 70,699,033 M109L probably benign Het
Il1f5 G A 2: 24,279,714 A29T probably damaging Het
Kif13b C T 14: 64,767,619 T1120I probably benign Het
Kmt2c A G 5: 25,310,835 I2670T possibly damaging Het
Lcp2 A G 11: 34,082,501 M360V probably benign Het
Ldlrad4 A G 18: 68,235,780 S103G probably benign Het
Loxl4 T C 19: 42,608,270 K88E probably damaging Het
Ltbp2 C A 12: 84,853,912 R192L probably damaging Het
Mast2 C A 4: 116,317,732 G475V probably damaging Het
Meis1 A C 11: 18,905,631 probably null Het
Mroh3 T C 1: 136,200,937 probably null Het
Myo5b C T 18: 74,770,385 A1824V probably benign Het
Nectin3 C T 16: 46,458,124 V303M probably benign Het
Olfr472 T C 7: 107,902,950 S78P possibly damaging Het
Peak1 T C 9: 56,258,211 N811S probably benign Het
Pik3ca C T 3: 32,462,821 A1066V probably benign Het
Rnf103 A G 6: 71,505,824 T153A possibly damaging Het
Sacs G A 14: 61,211,160 V3552I probably damaging Het
Speg T A 1: 75,426,875 M2621K probably benign Het
Stfa2l1 T C 16: 36,156,901 I22T probably damaging Het
Tbpl2 G A 2: 24,094,703 P144L probably benign Het
Tmem219 T C 7: 126,896,826 N119S possibly damaging Het
Ush2a A G 1: 188,910,887 T4149A probably benign Het
Wdr46 C A 17: 33,941,852 P197T probably damaging Het
Wee2 C T 6: 40,455,105 R203C probably damaging Het
Other mutations in Sgca
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01123:Sgca APN 11 94972287 missense probably damaging 1.00
IGL01479:Sgca APN 11 94963378 nonsense probably null
IGL02153:Sgca APN 11 94963284 missense probably damaging 1.00
IGL02713:Sgca APN 11 94971305 missense probably damaging 1.00
IGL02928:Sgca APN 11 94972303 missense probably damaging 1.00
IGL03185:Sgca APN 11 94970784 missense probably benign 0.00
R0602:Sgca UTSW 11 94963235 missense possibly damaging 0.94
R0834:Sgca UTSW 11 94970686 nonsense probably null
R1547:Sgca UTSW 11 94969433 missense probably damaging 1.00
R1703:Sgca UTSW 11 94969391 missense probably damaging 0.97
R4110:Sgca UTSW 11 94972570 missense possibly damaging 0.63
R4112:Sgca UTSW 11 94972570 missense possibly damaging 0.63
R4796:Sgca UTSW 11 94970727 unclassified probably null
R5301:Sgca UTSW 11 94963331 missense probably damaging 1.00
R6301:Sgca UTSW 11 94972567 missense probably damaging 1.00
R6510:Sgca UTSW 11 94963232 missense probably benign 0.36
R7110:Sgca UTSW 11 94963401 critical splice acceptor site probably null
R7121:Sgca UTSW 11 94969547 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- AGTCTTCAAGATTGGCACCAG -3'
(R):5'- GCCAGCATAGAGGCATCAAG -3'

Sequencing Primer
(F):5'- GGCAGATCTCTATAAGTTCAAGGCC -3'
(R):5'- ATCAAGGCCCTGGGGGTG -3'
Posted On2018-06-06