Incidental Mutation 'R6453:Ankrd44'
ID520086
Institutional Source Beutler Lab
Gene Symbol Ankrd44
Ensembl Gene ENSMUSG00000052331
Gene Nameankyrin repeat domain 44
SynonymsE130014H08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.222) question?
Stock #R6453 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location54645340-54926387 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 54657704 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000137616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044359] [ENSMUST00000178226] [ENSMUST00000179030]
Predicted Effect probably null
Transcript: ENSMUST00000044359
SMART Domains Protein: ENSMUSP00000040327
Gene: ENSMUSG00000052331

DomainStartEndE-ValueType
ANK 7 36 2.55e2 SMART
ANK 40 69 3.23e-4 SMART
ANK 73 102 1.12e-3 SMART
ANK 106 135 1.65e-1 SMART
ANK 139 168 1.6e-8 SMART
ANK 172 201 4.97e-5 SMART
ANK 205 234 1.1e-6 SMART
ANK 238 267 9.7e-8 SMART
ANK 271 301 1.11e-2 SMART
ANK 305 334 9.35e-1 SMART
ANK 338 367 2.02e-5 SMART
ANK 371 400 5.98e1 SMART
ANK 422 451 7.13e-6 SMART
ANK 455 484 1.18e-6 SMART
ANK 488 545 1.17e2 SMART
ANK 549 579 3.31e-1 SMART
ANK 584 613 3.91e-3 SMART
ANK 617 646 1.43e-5 SMART
ANK 651 680 2.73e-2 SMART
ANK 687 716 5.41e-6 SMART
ANK 720 749 5.53e-3 SMART
ANK 753 785 1.52e0 SMART
ANK 789 819 9.27e-5 SMART
ANK 821 851 1.52e0 SMART
ANK 856 885 6.02e-4 SMART
ANK 889 919 3.08e-1 SMART
ANK 923 955 3.36e-2 SMART
ANK 959 988 6.26e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177704
Predicted Effect probably benign
Transcript: ENSMUST00000178156
Predicted Effect probably null
Transcript: ENSMUST00000178226
SMART Domains Protein: ENSMUSP00000136802
Gene: ENSMUSG00000052331

DomainStartEndE-ValueType
ANK 2 31 1.1e-6 SMART
ANK 35 64 9.7e-8 SMART
ANK 68 98 1.11e-2 SMART
ANK 102 131 9.35e-1 SMART
ANK 135 164 2.02e-5 SMART
ANK 168 197 5.98e1 SMART
ANK 219 248 7.13e-6 SMART
ANK 252 281 1.18e-6 SMART
ANK 285 342 1.17e2 SMART
ANK 346 376 3.31e-1 SMART
ANK 381 410 3.91e-3 SMART
ANK 414 443 1.43e-5 SMART
ANK 448 477 2.73e-2 SMART
ANK 484 513 5.41e-6 SMART
ANK 517 546 5.53e-3 SMART
ANK 550 582 1.52e0 SMART
ANK 586 616 9.27e-5 SMART
ANK 618 648 1.52e0 SMART
ANK 653 682 6.02e-4 SMART
ANK 686 716 3.08e-1 SMART
ANK 720 752 3.36e-2 SMART
ANK 756 785 6.26e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000179030
SMART Domains Protein: ENSMUSP00000137616
Gene: ENSMUSG00000052331

DomainStartEndE-ValueType
ANK 7 36 2.55e2 SMART
ANK 40 69 3.23e-4 SMART
ANK 73 102 1.12e-3 SMART
ANK 106 135 1.65e-1 SMART
ANK 139 168 1.6e-8 SMART
ANK 172 201 4.97e-5 SMART
ANK 205 234 1.1e-6 SMART
ANK 238 267 9.7e-8 SMART
ANK 271 301 1.11e-2 SMART
ANK 305 334 9.35e-1 SMART
ANK 338 367 2.02e-5 SMART
ANK 371 400 3.26e0 SMART
ANK 404 433 7.13e-6 SMART
ANK 437 466 1.18e-6 SMART
ANK 470 527 1.17e2 SMART
ANK 531 561 3.31e-1 SMART
ANK 566 595 3.91e-3 SMART
ANK 599 628 1.43e-5 SMART
ANK 633 662 2.73e-2 SMART
ANK 669 698 5.41e-6 SMART
ANK 702 731 5.53e-3 SMART
ANK 735 767 1.52e0 SMART
ANK 771 801 9.27e-5 SMART
ANK 803 833 1.52e0 SMART
ANK 838 867 6.02e-4 SMART
ANK 871 901 3.08e-1 SMART
ANK 905 937 3.36e-2 SMART
ANK 941 970 6.26e-2 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.6%
  • 20x: 92.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F07Rik A G 2: 173,528,259 Y109C probably benign Het
2300002M23Rik C T 17: 35,568,212 S149L possibly damaging Het
A830018L16Rik A T 1: 11,798,558 D354V possibly damaging Het
Acta2 G A 19: 34,246,657 T150I probably damaging Het
Adgra1 T A 7: 139,875,427 S324T probably benign Het
B430306N03Rik T A 17: 48,316,736 W22R probably damaging Het
C130060K24Rik G A 6: 65,453,030 G237S possibly damaging Het
Ccdc162 A T 10: 41,550,825 V2024E probably damaging Het
Cers6 C T 2: 69,047,169 H164Y probably benign Het
Chd3 T A 11: 69,350,112 K1458* probably null Het
Col3a1 G A 1: 45,339,378 probably benign Het
Cyb5d2 T G 11: 72,782,760 T3P probably benign Het
Dennd1b A G 1: 139,143,948 Y468C probably benign Het
Dnajc14 A G 10: 128,807,490 E427G probably damaging Het
Exoc7 T C 11: 116,293,969 probably null Het
Fat2 A G 11: 55,282,216 I2557T probably benign Het
Flt1 T C 5: 147,683,941 D131G possibly damaging Het
Frem1 G T 4: 82,914,825 S1858* probably null Het
Garem1 T A 18: 21,148,739 I187F probably damaging Het
Gldc A T 19: 30,116,517 I700N probably damaging Het
Gm15922 C G 7: 3,737,320 A301P probably damaging Het
Gpatch4 A G 3: 88,055,005 E175G probably damaging Het
Gria2 A G 3: 80,740,974 Y152H possibly damaging Het
H2-Q2 C T 17: 35,344,895 L251F probably benign Het
Hectd4 G A 5: 121,350,592 G3649R probably damaging Het
Hormad1 A G 3: 95,578,257 E252G probably benign Het
Kif14 A G 1: 136,482,304 probably null Het
Lmcd1 A G 6: 112,315,828 T214A probably benign Het
Macrod2 A G 2: 142,176,625 E226G probably damaging Het
Mcm4 A T 16: 15,630,409 L428Q probably damaging Het
Msh6 T A 17: 87,985,739 Y641N probably damaging Het
Myo7a C T 7: 98,073,167 V1184M probably benign Het
Nipa2 A T 7: 55,935,821 M142K probably damaging Het
Olfr905 T C 9: 38,473,575 I276T probably benign Het
Parvg A T 15: 84,328,925 E122V probably null Het
Pclo T A 5: 14,676,789 probably benign Het
Pik3cd A G 4: 149,652,302 V933A probably damaging Het
Qpctl C T 7: 19,141,297 V337I probably damaging Het
Ralgapa1 A G 12: 55,738,319 W719R probably damaging Het
Rangrf A G 11: 68,973,552 L28P probably damaging Het
Rbbp9 G T 2: 144,549,134 Q38K probably benign Het
Rnf169 C T 7: 99,935,227 M246I probably benign Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,917 probably benign Het
Sdk1 A G 5: 142,096,921 D1098G probably damaging Het
Sgsm3 T A 15: 81,011,314 S689T probably damaging Het
Slc13a3 C T 2: 165,411,947 V429M possibly damaging Het
Slc30a5 A T 13: 100,814,689 D228E probably benign Het
Slc46a3 A G 5: 147,886,390 I214T possibly damaging Het
Slc7a15 T C 12: 8,534,490 M347V possibly damaging Het
Slc9a2 A T 1: 40,742,621 I337F possibly damaging Het
Sostdc1 C A 12: 36,314,408 P39T probably benign Het
Speg A G 1: 75,417,972 N1775S probably benign Het
Spg7 A G 8: 123,079,423 K291E possibly damaging Het
Sptbn2 A T 19: 4,744,180 R1471W possibly damaging Het
Thada T C 17: 84,416,323 E1101G probably damaging Het
Trpm6 G A 19: 18,829,990 A1033T probably damaging Het
Ttll6 G A 11: 96,158,727 R757H probably benign Het
Other mutations in Ankrd44
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00578:Ankrd44 APN 1 54662647 splice site probably benign
IGL00839:Ankrd44 APN 1 54667435 missense probably benign 0.27
IGL01145:Ankrd44 APN 1 54762259 critical splice donor site probably null
IGL01380:Ankrd44 APN 1 54727565 missense probably benign 0.00
IGL01415:Ankrd44 APN 1 54752928 missense probably damaging 1.00
IGL01958:Ankrd44 APN 1 54766966 missense probably damaging 0.99
IGL02014:Ankrd44 APN 1 54657620 missense possibly damaging 0.95
IGL02745:Ankrd44 APN 1 54766791 missense probably damaging 1.00
IGL03008:Ankrd44 APN 1 54766809 missense probably damaging 1.00
wilderness UTSW 1 54735034 synonymous silent
PIT4812001:Ankrd44 UTSW 1 54723038 nonsense probably null
R0416:Ankrd44 UTSW 1 54743339 missense possibly damaging 0.63
R0554:Ankrd44 UTSW 1 54763758 missense probably benign 0.00
R0575:Ankrd44 UTSW 1 54762310 missense probably damaging 1.00
R1323:Ankrd44 UTSW 1 54766450 splice site probably benign
R1605:Ankrd44 UTSW 1 54828622 missense probably benign 0.36
R2032:Ankrd44 UTSW 1 54723009 splice site probably null
R4458:Ankrd44 UTSW 1 54762391 missense possibly damaging 0.92
R4610:Ankrd44 UTSW 1 54766748 intron probably benign
R4727:Ankrd44 UTSW 1 54667417 missense probably benign 0.05
R4780:Ankrd44 UTSW 1 54763757 missense probably benign 0.00
R4801:Ankrd44 UTSW 1 54762316 missense probably damaging 1.00
R4802:Ankrd44 UTSW 1 54762316 missense probably damaging 1.00
R4810:Ankrd44 UTSW 1 54735143 intron probably benign
R4961:Ankrd44 UTSW 1 54663912 missense probably damaging 1.00
R5053:Ankrd44 UTSW 1 54735089 nonsense probably null
R5093:Ankrd44 UTSW 1 54763718 missense probably damaging 1.00
R5155:Ankrd44 UTSW 1 54778330 missense probably benign 0.43
R5248:Ankrd44 UTSW 1 54667380 missense probably damaging 1.00
R5306:Ankrd44 UTSW 1 54926203 utr 5 prime probably benign
R5595:Ankrd44 UTSW 1 54735050 missense probably damaging 1.00
R5595:Ankrd44 UTSW 1 54762347 missense probably damaging 1.00
R6288:Ankrd44 UTSW 1 54763763 missense probably damaging 1.00
R6332:Ankrd44 UTSW 1 54762273 missense probably damaging 1.00
R6610:Ankrd44 UTSW 1 54655087 missense probably benign 0.02
R6699:Ankrd44 UTSW 1 54762445 missense probably damaging 1.00
R6905:Ankrd44 UTSW 1 54792494 missense probably damaging 1.00
R7173:Ankrd44 UTSW 1 54766391 missense probably damaging 1.00
R7178:Ankrd44 UTSW 1 54649440 missense
R7219:Ankrd44 UTSW 1 54766910 missense probably damaging 1.00
R7276:Ankrd44 UTSW 1 54735080 missense probably benign 0.05
R7283:Ankrd44 UTSW 1 54729796 missense probably damaging 1.00
R7414:Ankrd44 UTSW 1 54667380 missense probably damaging 1.00
Z1088:Ankrd44 UTSW 1 54658982 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCCAAGGATTGTGCATGTATAC -3'
(R):5'- CCTTAATGGAATCAGTGGAGGG -3'

Sequencing Primer
(F):5'- GCTTCATAGCTAGTTCAAGGCCAG -3'
(R):5'- GGGTCAGTGTACACTATTGTAGC -3'
Posted On2018-06-06