Incidental Mutation 'R6453:Gria2'
ID520095
Institutional Source Beutler Lab
Gene Symbol Gria2
Ensembl Gene ENSMUSG00000033981
Gene Nameglutamate receptor, ionotropic, AMPA2 (alpha 2)
SynonymsGlur2, Glur-2, GluR-B, GluA2, GluR2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.350) question?
Stock #R6453 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location80681450-80802835 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 80740974 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 152 (Y152H)
Ref Sequence ENSEMBL: ENSMUSP00000141447 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075316] [ENSMUST00000107745] [ENSMUST00000192463]
Predicted Effect possibly damaging
Transcript: ENSMUST00000075316
AA Change: Y152H

PolyPhen 2 Score 0.747 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000074787
Gene: ENSMUSG00000033981
AA Change: Y152H

DomainStartEndE-ValueType
Pfam:ANF_receptor 49 379 2.7e-58 PFAM
PBPe 415 790 3.75e-132 SMART
Lig_chan-Glu_bd 425 490 2.96e-31 SMART
low complexity region 820 832 N/A INTRINSIC
low complexity region 853 865 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000107745
AA Change: Y152H

PolyPhen 2 Score 0.790 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000103374
Gene: ENSMUSG00000033981
AA Change: Y152H

DomainStartEndE-ValueType
Pfam:ANF_receptor 47 379 4.8e-53 PFAM
PBPe 415 790 8.16e-133 SMART
Lig_chan-Glu_bd 425 490 2.96e-31 SMART
low complexity region 820 832 N/A INTRINSIC
low complexity region 853 865 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000192463
AA Change: Y152H

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000141447
Gene: ENSMUSG00000033981
AA Change: Y152H

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:ANF_receptor 47 379 1.7e-51 PFAM
PBPe 415 770 1.2e-105 SMART
Lig_chan-Glu_bd 425 490 2.2e-35 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193645
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194383
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194523
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195062
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.6%
  • 20x: 92.2%
Validation Efficiency
MGI Phenotype FUNCTION: Glutamate receptors are the predominant excitatory neurotransmitter receptors in the mammalian brain and are activated in a variety of normal neurophysiologic processes. This gene product belongs to a family of glutamate receptors that are sensitive to alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate (AMPA), and function as ligand-activated cation channels. These channels are assembled from 4 related subunits, Gria1-4. The subunit encoded by this gene (Gria2) is subject to RNA editing (CAG->CGG; Q->R) within the second transmembrane domain, which is thought to render the channel impermeable to Ca(2+). Alternative splicing, resulting in transcript variants encoding different isoforms, (including the flip and flop isoforms that vary in their signal transduction properties), has been noted for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit epilepsy, deficient dendritic architecture, altered exploratory behavior, impaired motor and learning performance, and increased mortality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F07Rik A G 2: 173,528,259 Y109C probably benign Het
2300002M23Rik C T 17: 35,568,212 S149L possibly damaging Het
A830018L16Rik A T 1: 11,798,558 D354V possibly damaging Het
Acta2 G A 19: 34,246,657 T150I probably damaging Het
Adgra1 T A 7: 139,875,427 S324T probably benign Het
Ankrd44 A T 1: 54,657,704 probably null Het
B430306N03Rik T A 17: 48,316,736 W22R probably damaging Het
C130060K24Rik G A 6: 65,453,030 G237S possibly damaging Het
Ccdc162 A T 10: 41,550,825 V2024E probably damaging Het
Cers6 C T 2: 69,047,169 H164Y probably benign Het
Chd3 T A 11: 69,350,112 K1458* probably null Het
Col3a1 G A 1: 45,339,378 probably benign Het
Cyb5d2 T G 11: 72,782,760 T3P probably benign Het
Dennd1b A G 1: 139,143,948 Y468C probably benign Het
Dnajc14 A G 10: 128,807,490 E427G probably damaging Het
Exoc7 T C 11: 116,293,969 probably null Het
Fat2 A G 11: 55,282,216 I2557T probably benign Het
Flt1 T C 5: 147,683,941 D131G possibly damaging Het
Frem1 G T 4: 82,914,825 S1858* probably null Het
Garem1 T A 18: 21,148,739 I187F probably damaging Het
Gldc A T 19: 30,116,517 I700N probably damaging Het
Gm15922 C G 7: 3,737,320 A301P probably damaging Het
Gpatch4 A G 3: 88,055,005 E175G probably damaging Het
H2-Q2 C T 17: 35,344,895 L251F probably benign Het
Hectd4 G A 5: 121,350,592 G3649R probably damaging Het
Hormad1 A G 3: 95,578,257 E252G probably benign Het
Kif14 A G 1: 136,482,304 probably null Het
Lmcd1 A G 6: 112,315,828 T214A probably benign Het
Macrod2 A G 2: 142,176,625 E226G probably damaging Het
Mcm4 A T 16: 15,630,409 L428Q probably damaging Het
Msh6 T A 17: 87,985,739 Y641N probably damaging Het
Myo7a C T 7: 98,073,167 V1184M probably benign Het
Nipa2 A T 7: 55,935,821 M142K probably damaging Het
Olfr905 T C 9: 38,473,575 I276T probably benign Het
Parvg A T 15: 84,328,925 E122V probably null Het
Pclo T A 5: 14,676,789 probably benign Het
Pik3cd A G 4: 149,652,302 V933A probably damaging Het
Qpctl C T 7: 19,141,297 V337I probably damaging Het
Ralgapa1 A G 12: 55,738,319 W719R probably damaging Het
Rangrf A G 11: 68,973,552 L28P probably damaging Het
Rbbp9 G T 2: 144,549,134 Q38K probably benign Het
Rnf169 C T 7: 99,935,227 M246I probably benign Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,917 probably benign Het
Sdk1 A G 5: 142,096,921 D1098G probably damaging Het
Sgsm3 T A 15: 81,011,314 S689T probably damaging Het
Slc13a3 C T 2: 165,411,947 V429M possibly damaging Het
Slc30a5 A T 13: 100,814,689 D228E probably benign Het
Slc46a3 A G 5: 147,886,390 I214T possibly damaging Het
Slc7a15 T C 12: 8,534,490 M347V possibly damaging Het
Slc9a2 A T 1: 40,742,621 I337F possibly damaging Het
Sostdc1 C A 12: 36,314,408 P39T probably benign Het
Speg A G 1: 75,417,972 N1775S probably benign Het
Spg7 A G 8: 123,079,423 K291E possibly damaging Het
Sptbn2 A T 19: 4,744,180 R1471W possibly damaging Het
Thada T C 17: 84,416,323 E1101G probably damaging Het
Trpm6 G A 19: 18,829,990 A1033T probably damaging Het
Ttll6 G A 11: 96,158,727 R757H probably benign Het
Other mutations in Gria2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00796:Gria2 APN 3 80710790 missense probably benign 0.12
IGL00832:Gria2 APN 3 80707251 missense probably damaging 1.00
IGL01086:Gria2 APN 3 80692381 missense probably damaging 1.00
IGL01409:Gria2 APN 3 80707697 critical splice donor site probably null
IGL01924:Gria2 APN 3 80710331 missense probably benign 0.13
IGL01999:Gria2 APN 3 80732091 missense probably damaging 1.00
IGL02355:Gria2 APN 3 80706937 missense probably damaging 1.00
IGL02362:Gria2 APN 3 80706937 missense probably damaging 1.00
IGL02389:Gria2 APN 3 80709422 missense probably benign 0.14
IGL02444:Gria2 APN 3 80702553 missense possibly damaging 0.65
IGL02532:Gria2 APN 3 80706999 missense probably damaging 1.00
IGL02991:Gria2 UTSW 3 80707809 nonsense probably null
R0015:Gria2 UTSW 3 80707767 missense probably damaging 1.00
R0148:Gria2 UTSW 3 80707731 missense probably damaging 1.00
R0201:Gria2 UTSW 3 80707838 missense probably damaging 1.00
R0411:Gria2 UTSW 3 80710858 splice site probably benign
R0551:Gria2 UTSW 3 80732026 splice site probably benign
R0655:Gria2 UTSW 3 80732070 nonsense probably null
R0866:Gria2 UTSW 3 80722024 splice site probably benign
R1393:Gria2 UTSW 3 80707098 missense probably damaging 1.00
R1458:Gria2 UTSW 3 80732045 missense possibly damaging 0.71
R1563:Gria2 UTSW 3 80691397 missense probably damaging 0.96
R1771:Gria2 UTSW 3 80692301 nonsense probably null
R1775:Gria2 UTSW 3 80691338 missense probably benign 0.09
R1902:Gria2 UTSW 3 80722108 missense probably damaging 0.98
R1993:Gria2 UTSW 3 80802357 missense probably benign
R1994:Gria2 UTSW 3 80802357 missense probably benign
R1995:Gria2 UTSW 3 80802357 missense probably benign
R2001:Gria2 UTSW 3 80710805 missense probably benign 0.28
R2389:Gria2 UTSW 3 80702625 missense probably damaging 1.00
R2520:Gria2 UTSW 3 80706962 missense probably damaging 1.00
R2679:Gria2 UTSW 3 80740953 splice site probably benign
R2865:Gria2 UTSW 3 80732085 missense probably benign 0.00
R2869:Gria2 UTSW 3 80702492 missense probably damaging 1.00
R2869:Gria2 UTSW 3 80702492 missense probably damaging 1.00
R2870:Gria2 UTSW 3 80702492 missense probably damaging 1.00
R2870:Gria2 UTSW 3 80702492 missense probably damaging 1.00
R2871:Gria2 UTSW 3 80702492 missense probably damaging 1.00
R2871:Gria2 UTSW 3 80702492 missense probably damaging 1.00
R2872:Gria2 UTSW 3 80702492 missense probably damaging 1.00
R2872:Gria2 UTSW 3 80702492 missense probably damaging 1.00
R3716:Gria2 UTSW 3 80741004 missense possibly damaging 0.77
R3967:Gria2 UTSW 3 80710777 missense possibly damaging 0.95
R4285:Gria2 UTSW 3 80707662 intron probably benign
R4611:Gria2 UTSW 3 80692492 missense probably damaging 0.99
R4612:Gria2 UTSW 3 80732051 missense probably damaging 1.00
R4616:Gria2 UTSW 3 80706897 missense probably damaging 1.00
R4706:Gria2 UTSW 3 80740990 missense probably benign
R4996:Gria2 UTSW 3 80707141 missense probably damaging 0.99
R5502:Gria2 UTSW 3 80706945 missense probably damaging 1.00
R5930:Gria2 UTSW 3 80707249 missense possibly damaging 0.91
R6142:Gria2 UTSW 3 80801717 missense probably benign 0.13
R6233:Gria2 UTSW 3 80707203 missense probably damaging 0.99
R6317:Gria2 UTSW 3 80741004 missense possibly damaging 0.79
R6526:Gria2 UTSW 3 80692469 missense probably damaging 1.00
R6545:Gria2 UTSW 3 80741144 missense probably damaging 0.99
R6574:Gria2 UTSW 3 80689296 missense probably damaging 0.99
R6720:Gria2 UTSW 3 80802304 missense probably benign 0.37
R7009:Gria2 UTSW 3 80706972 missense probably damaging 1.00
R7049:Gria2 UTSW 3 80689327 missense probably damaging 0.99
R7191:Gria2 UTSW 3 80732085 missense probably benign 0.24
R7225:Gria2 UTSW 3 80802631 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GGTTCTGAATTCTATCCCTCTGGAC -3'
(R):5'- CCCAGTTTTCAAGAGGCGTC -3'

Sequencing Primer
(F):5'- GAATTCTATCCCTCTGGACTCTTG -3'
(R):5'- CCAGTTTTCAAGAGGCGTCTATGC -3'
Posted On2018-06-06