Incidental Mutation 'R6456:Ttc21b'
ID520149
Institutional Source Beutler Lab
Gene Symbol Ttc21b
Ensembl Gene ENSMUSG00000034848
Gene Nametetratricopeptide repeat domain 21B
Synonymsline 158, Thm1, aln, 2410066K11Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6456 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location66184327-66256617 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 66188331 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 1244 (Q1244R)
Ref Sequence ENSEMBL: ENSMUSP00000131758 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102718] [ENSMUST00000125446]
Predicted Effect probably damaging
Transcript: ENSMUST00000102718
AA Change: Q1244R

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000099779
Gene: ENSMUSG00000034848
AA Change: Q1244R

DomainStartEndE-ValueType
Blast:TPR 109 141 5e-12 BLAST
Blast:TPR 178 211 3e-12 BLAST
TPR 324 357 4.21e1 SMART
low complexity region 379 390 N/A INTRINSIC
TPR 492 525 8.51e0 SMART
TPR 526 559 5.92e1 SMART
TPR 563 596 7.69e1 SMART
TPR 721 754 3.07e-5 SMART
TPR 755 788 9.45e0 SMART
TPR 790 821 9.24e1 SMART
TPR 830 863 3.05e0 SMART
TPR 883 916 1.55e-1 SMART
TPR 917 950 8.74e0 SMART
TPR 951 984 6.75e1 SMART
Blast:TPR 1023 1054 5e-13 BLAST
Blast:TPR 1156 1189 1e-12 BLAST
TPR 1196 1229 9.7e0 SMART
TPR 1265 1298 1.02e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000125446
AA Change: Q1244R

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000131758
Gene: ENSMUSG00000034848
AA Change: Q1244R

DomainStartEndE-ValueType
Blast:TPR 108 141 3e-12 BLAST
Blast:TPR 178 211 3e-12 BLAST
TPR 324 357 4.21e1 SMART
low complexity region 379 390 N/A INTRINSIC
TPR 492 525 8.51e0 SMART
TPR 526 559 5.92e1 SMART
TPR 563 596 7.69e1 SMART
TPR 721 754 3.07e-5 SMART
TPR 755 788 9.45e0 SMART
TPR 790 821 9.24e1 SMART
TPR 830 863 3.05e0 SMART
TPR 883 916 1.55e-1 SMART
TPR 917 950 8.74e0 SMART
TPR 951 984 6.75e1 SMART
Blast:TPR 1023 1054 4e-13 BLAST
Blast:TPR 1156 1189 9e-13 BLAST
TPR 1196 1229 9.7e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128859
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of TTC21 family, containing several tetratricopeptide repeat (TPR) domains. This protein is localized to the cilium axoneme, and may play a role in retrograde intraflagellar transport in cilia. Mutations in this gene are associated with various ciliopathies, nephronophthisis 12, and asphyxiating thoracic dystrophy 4. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous mutation of this gene is embryonic lethal. Mutant embryos exhibit several deformities including polydactyly, microphthalmia, irregular shape of the long bones, rib fusion and truncation, neural tube defects, and abnormal brain structure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T A 1: 26,685,169 H310L probably damaging Het
9930021J03Rik G A 19: 29,716,514 P1860S possibly damaging Het
Abca13 A T 11: 9,290,474 H779L possibly damaging Het
Abca7 T C 10: 80,015,150 V2097A probably null Het
Adam8 A G 7: 139,986,788 S524P possibly damaging Het
Anapc2 T C 2: 25,280,195 M575T probably damaging Het
Arhgap42 T A 9: 9,005,822 I736L probably benign Het
AU040320 A G 4: 126,842,491 N789S probably benign Het
Bmi1 A G 2: 18,682,247 Y46C probably damaging Het
Ccdc125 T C 13: 100,696,309 S465P possibly damaging Het
Cd180 C T 13: 102,702,836 L76F probably damaging Het
Cep135 T C 5: 76,591,724 probably benign Het
Col6a5 G A 9: 105,945,477 T227I unknown Het
Cyp4a29 G T 4: 115,251,184 M368I probably benign Het
Ddx28 T A 8: 106,010,368 I353F possibly damaging Het
Ddx58 T A 4: 40,213,838 N607Y possibly damaging Het
Dhx40 G A 11: 86,784,974 T198M probably damaging Het
Fam71f1 A G 6: 29,334,046 N299S probably benign Het
Fat4 G A 3: 38,983,979 V3927M possibly damaging Het
Gm10226 G T 17: 21,692,025 G56* probably null Het
Gm11127 A T 17: 36,056,610 Y279N probably damaging Het
Itsn2 T G 12: 4,629,923 probably benign Het
Lrrc8a A G 2: 30,255,474 D100G probably benign Het
Madd T C 2: 91,178,191 H122R probably benign Het
Mfsd4b3 C G 10: 39,947,320 V315L probably benign Het
Mki67 C G 7: 135,699,475 A1277P possibly damaging Het
Nlrp9b T A 7: 20,048,778 N872K probably damaging Het
Npas1 T C 7: 16,461,926 T274A probably benign Het
Nrm A T 17: 35,865,400 probably null Het
Olfr418 A T 1: 173,270,538 D121V probably damaging Het
Pdilt T A 7: 119,500,483 L187F probably damaging Het
Pkdcc T C 17: 83,220,119 I242T probably damaging Het
Plch2 C A 4: 154,993,002 D535Y probably damaging Het
Pmpca T A 2: 26,395,167 I468N probably damaging Het
Prpf4 T C 4: 62,414,632 probably null Het
Rcc1 A G 4: 132,334,116 S361P probably benign Het
Rnf213 A G 11: 119,459,966 I3876V probably benign Het
Sall2 T A 14: 52,313,593 Q715L probably damaging Het
Sall2 G A 14: 52,313,594 Q713* probably null Het
Sin3a A G 9: 57,113,701 S1004G possibly damaging Het
Sltm C T 9: 70,542,987 T23M probably damaging Het
Sspo A G 6: 48,451,806 E385G probably benign Het
Syne3 G T 12: 104,940,704 R775S possibly damaging Het
Szt2 A T 4: 118,376,697 probably benign Het
Tlk2 T C 11: 105,221,273 S151P probably benign Het
Trabd2b C T 4: 114,586,560 R305C probably damaging Het
Vmn2r125 A G 4: 156,351,062 N245S probably benign Het
Wdr34 T C 2: 30,032,767 S323G probably benign Het
Wdr64 G A 1: 175,785,609 probably null Het
Wdr70 G A 15: 7,885,637 T550M possibly damaging Het
Wdr78 A C 4: 103,049,549 M689R probably benign Het
Other mutations in Ttc21b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Ttc21b APN 2 66242775 missense probably benign 0.00
IGL00467:Ttc21b APN 2 66188364 missense probably damaging 1.00
IGL00721:Ttc21b APN 2 66226778 missense probably benign 0.06
IGL00837:Ttc21b APN 2 66235571 critical splice donor site probably null
IGL01317:Ttc21b APN 2 66188356 missense probably benign 0.00
IGL01485:Ttc21b APN 2 66251890 splice site probably benign
IGL01739:Ttc21b APN 2 66237856 missense probably benign
IGL02282:Ttc21b APN 2 66191737 missense probably damaging 0.96
IGL02431:Ttc21b APN 2 66251885 splice site probably benign
IGL02478:Ttc21b APN 2 66188280 missense probably benign 0.05
IGL02487:Ttc21b APN 2 66235156 missense probably benign 0.02
IGL03327:Ttc21b APN 2 66237848 missense possibly damaging 0.92
IGL03346:Ttc21b APN 2 66237848 missense possibly damaging 0.92
plus-sized UTSW 2 66242679 missense probably damaging 1.00
PIT4696001:Ttc21b UTSW 2 66231219 intron probably null
R0049:Ttc21b UTSW 2 66223564 missense probably damaging 1.00
R0049:Ttc21b UTSW 2 66223564 missense probably damaging 1.00
R0373:Ttc21b UTSW 2 66188326 missense probably damaging 0.99
R0440:Ttc21b UTSW 2 66236382 missense probably benign 0.03
R0504:Ttc21b UTSW 2 66222798 splice site probably benign
R0600:Ttc21b UTSW 2 66239570 missense probably damaging 0.99
R0621:Ttc21b UTSW 2 66226011 missense probably benign 0.07
R0633:Ttc21b UTSW 2 66236233 missense probably benign
R0863:Ttc21b UTSW 2 66242773 missense probably benign
R1617:Ttc21b UTSW 2 66226035 missense probably benign 0.22
R1837:Ttc21b UTSW 2 66197762 missense probably benign 0.01
R1844:Ttc21b UTSW 2 66223577 nonsense probably null
R2120:Ttc21b UTSW 2 66226754 missense probably benign 0.12
R2205:Ttc21b UTSW 2 66235123 missense possibly damaging 0.51
R2392:Ttc21b UTSW 2 66207450 critical splice donor site probably null
R3689:Ttc21b UTSW 2 66224144 missense probably benign 0.22
R3810:Ttc21b UTSW 2 66252233 critical splice acceptor site probably null
R3847:Ttc21b UTSW 2 66242679 missense probably damaging 1.00
R3897:Ttc21b UTSW 2 66235069 missense probably benign 0.01
R4561:Ttc21b UTSW 2 66186218 missense probably damaging 1.00
R4671:Ttc21b UTSW 2 66226913 missense possibly damaging 0.66
R5161:Ttc21b UTSW 2 66229023 missense probably damaging 0.98
R5274:Ttc21b UTSW 2 66236283 missense possibly damaging 0.89
R5594:Ttc21b UTSW 2 66236235 missense probably benign 0.39
R6210:Ttc21b UTSW 2 66236354 missense probably benign 0.00
R6305:Ttc21b UTSW 2 66188270 missense probably damaging 0.99
R6482:Ttc21b UTSW 2 66226900 missense probably benign 0.12
R6645:Ttc21b UTSW 2 66236377 missense probably benign 0.01
R6800:Ttc21b UTSW 2 66208650 splice site probably null
R6815:Ttc21b UTSW 2 66226790 missense probably benign 0.00
R6959:Ttc21b UTSW 2 66231312 missense probably benign 0.05
R7125:Ttc21b UTSW 2 66236326 missense probably benign 0.00
R7265:Ttc21b UTSW 2 66210173 missense possibly damaging 0.89
R7283:Ttc21b UTSW 2 66208718 missense probably damaging 0.96
X0013:Ttc21b UTSW 2 66225950 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATCAGGTAAGTAACTCGCGATG -3'
(R):5'- CACAGGTTGGAGTGCCATTG -3'

Sequencing Primer
(F):5'- CTCGCGATGAGGATACAGCATTG -3'
(R):5'- GGAGTGCCATTGCTTTATACACCATG -3'
Posted On2018-06-06