Incidental Mutation 'R6533:Spta1'
ID520162
Institutional Source Beutler Lab
Gene Symbol Spta1
Ensembl Gene ENSMUSG00000026532
Gene Namespectrin alpha, erythrocytic 1
Synonymserythroid, Spna-1, ihj, Spna1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.506) question?
Stock #R6533 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location174172776-174248450 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 174244147 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 2231 (T2231I)
Ref Sequence ENSEMBL: ENSMUSP00000027817 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027817] [ENSMUST00000214725]
Predicted Effect probably damaging
Transcript: ENSMUST00000027817
AA Change: T2231I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027817
Gene: ENSMUSG00000026532
AA Change: T2231I

DomainStartEndE-ValueType
SPEC 55 153 3.62e-11 SMART
SPEC 159 259 1.84e-26 SMART
SPEC 265 365 1.56e-24 SMART
SPEC 371 471 8.35e-25 SMART
SPEC 477 577 1.19e-29 SMART
SPEC 583 682 2.43e-26 SMART
SPEC 688 788 1.3e-26 SMART
SPEC 794 894 1.66e-28 SMART
SPEC 900 1077 5.03e-19 SMART
SH3 978 1033 2.98e-15 SMART
SPEC 1083 1178 2.57e-16 SMART
SPEC 1184 1284 1.15e-27 SMART
SPEC 1290 1390 7.05e-23 SMART
SPEC 1396 1495 6.04e-22 SMART
SPEC 1501 1602 1.15e-27 SMART
SPEC 1608 1708 5.46e-29 SMART
SPEC 1714 1814 1.08e-32 SMART
SPEC 1820 1921 2.17e-23 SMART
SPEC 1927 2028 2.19e-19 SMART
SPEC 2042 2142 3.87e-11 SMART
SPEC 2156 2253 9.77e-8 SMART
low complexity region 2307 2318 N/A INTRINSIC
efhand_Ca_insen 2346 2414 2.37e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156092
Predicted Effect probably benign
Transcript: ENSMUST00000214725
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spectrin is an actin crosslinking and molecular scaffold protein that links the plasma membrane to the actin cytoskeleton, and functions in the determination of cell shape, arrangement of transmembrane proteins, and organization of organelles. It is a tetramer made up of alpha-beta dimers linked in a head-to-head arrangement. This gene is one member of a family of alpha-spectrin genes. The encoded protein is primarily composed of 22 spectrin repeats which are involved in dimer formation. It forms weaker tetramer interactions than non-erythrocytic alpha spectrin, which may increase the plasma membrane elasticity and deformability of red blood cells. Mutations in this gene result in a variety of hereditary red blood cell disorders, including elliptocytosis type 2, pyropoikilocytosis, and spherocytic hemolytic anemia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for spontaneous mutations exhibit microcytic, hypochromic, hemolytic anemia, jaundice, and high neonatal mortality. Heterozygotes of some alleles may exhibit a mild spherocytic transition. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010B08Rik C T 2: 173,719,835 probably benign Het
4932414N04Rik G T 2: 68,716,318 E115* probably null Het
Abhd16a G A 17: 35,098,809 probably null Het
Ankrd28 T A 14: 31,732,084 I244L possibly damaging Het
Barx2 T C 9: 31,912,979 Y38C probably damaging Het
Btn2a2 C A 13: 23,481,781 E294* probably null Het
Ceacam2 C G 7: 25,530,711 V157L probably benign Het
Ces2c T A 8: 104,852,093 F334L possibly damaging Het
Col7a1 T C 9: 108,961,358 I958T unknown Het
Cyhr1 C A 15: 76,647,730 E283* probably null Het
Dcp2 T A 18: 44,399,664 D82E probably benign Het
Dnah8 T C 17: 30,746,990 L2432S probably damaging Het
Dst A G 1: 34,303,509 D7582G probably benign Het
Fat3 T A 9: 15,998,899 I1936L probably benign Het
Gsdmc4 T A 15: 63,892,060 N396I probably damaging Het
Lonrf2 A C 1: 38,813,268 D167E probably benign Het
Marf1 T C 16: 14,115,799 D1575G probably benign Het
Med23 T C 10: 24,893,620 L101P probably damaging Het
Myh3 A G 11: 67,090,419 I703V probably damaging Het
Ncan G A 8: 70,096,357 A1257V probably benign Het
Nipal4 A T 11: 46,150,407 Y320* probably null Het
Obox5 A T 7: 15,757,607 Q24L probably benign Het
Orc1 T C 4: 108,597,447 S345P probably benign Het
P4hb A T 11: 120,571,643 I79N probably damaging Het
Phf3 A T 1: 30,806,318 I1262N probably damaging Het
Pigo A T 4: 43,022,697 N291K probably benign Het
Ppargc1b C T 18: 61,307,774 R691H possibly damaging Het
Ppm1m T C 9: 106,196,870 probably benign Het
Ptprd A T 4: 76,128,528 D500E probably damaging Het
Rab3gap2 T A 1: 185,232,954 probably null Het
Rnf214 A G 9: 45,900,063 S101P probably benign Het
Sdhc A G 1: 171,129,827 S162P possibly damaging Het
Stxbp2 T A 8: 3,642,683 D578E probably benign Het
Tacc2 A T 7: 130,622,837 E417D possibly damaging Het
Tas2r144 A T 6: 42,215,346 N7Y probably benign Het
Tasp1 A G 2: 139,834,357 *421R probably null Het
Tigd5 A G 15: 75,910,190 I134V possibly damaging Het
Tmem95 A T 11: 69,878,017 M1K probably null Het
Trappc10 T C 10: 78,188,894 M1134V probably damaging Het
Unc45a T G 7: 80,334,069 K326N probably damaging Het
Vmn1r59 A G 7: 5,454,464 V99A probably benign Het
Vmn2r4 T C 3: 64,415,098 T67A probably benign Het
Vmn2r85 A T 10: 130,426,660 M70K probably benign Het
Zkscan8 A G 13: 21,520,578 F325S probably damaging Het
Other mutations in Spta1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Spta1 APN 1 174208390 nonsense probably null
IGL01095:Spta1 APN 1 174213485 missense probably benign 0.02
IGL01144:Spta1 APN 1 174187263 missense probably benign 0.05
IGL01455:Spta1 APN 1 174203311 missense possibly damaging 0.78
IGL01541:Spta1 APN 1 174217159 missense probably benign 0.03
IGL01613:Spta1 APN 1 174208394 missense probably damaging 1.00
IGL01804:Spta1 APN 1 174244180 missense probably benign 0.42
IGL01859:Spta1 APN 1 174174372 missense probably damaging 1.00
IGL01898:Spta1 APN 1 174213862 missense probably benign 0.00
IGL02106:Spta1 APN 1 174203294 missense probably benign 0.02
IGL02166:Spta1 APN 1 174190231 missense probably damaging 1.00
IGL02224:Spta1 APN 1 174217689 critical splice donor site probably benign
IGL02318:Spta1 APN 1 174174463 missense possibly damaging 0.51
IGL02392:Spta1 APN 1 174218814 missense probably damaging 0.96
IGL02852:Spta1 APN 1 174244110 missense probably benign 0.24
IGL02861:Spta1 APN 1 174211598 missense probably damaging 1.00
IGL02982:Spta1 APN 1 174187288 missense probably benign 0.00
IGL03057:Spta1 APN 1 174181058 missense probably benign 0.19
IGL03215:Spta1 APN 1 174218743 missense probably damaging 1.00
IGL03263:Spta1 APN 1 174213918 missense probably damaging 0.99
IGL03272:Spta1 APN 1 174214144 missense probably benign 0.08
H8786:Spta1 UTSW 1 174179839 missense probably damaging 0.98
R0003:Spta1 UTSW 1 174205273 missense probably damaging 0.98
R0003:Spta1 UTSW 1 174205273 missense probably damaging 0.98
R0010:Spta1 UTSW 1 174217943 missense probably benign 0.03
R0010:Spta1 UTSW 1 174217943 missense probably benign 0.03
R0078:Spta1 UTSW 1 174207032 splice site probably benign
R0172:Spta1 UTSW 1 174230786 missense probably damaging 1.00
R0206:Spta1 UTSW 1 174192960 missense probably damaging 1.00
R0208:Spta1 UTSW 1 174192960 missense probably damaging 1.00
R0276:Spta1 UTSW 1 174217894 missense probably damaging 1.00
R0288:Spta1 UTSW 1 174243179 missense probably damaging 0.99
R0323:Spta1 UTSW 1 174218451 missense probably damaging 1.00
R0454:Spta1 UTSW 1 174213942 missense probably damaging 1.00
R0508:Spta1 UTSW 1 174224457 missense probably damaging 1.00
R0698:Spta1 UTSW 1 174181104 missense probably damaging 1.00
R0751:Spta1 UTSW 1 174184690 missense probably damaging 1.00
R0925:Spta1 UTSW 1 174174426 missense possibly damaging 0.85
R0941:Spta1 UTSW 1 174245205 unclassified probably benign
R1131:Spta1 UTSW 1 174185647 missense probably damaging 1.00
R1171:Spta1 UTSW 1 174211614 nonsense probably null
R1184:Spta1 UTSW 1 174184690 missense probably damaging 1.00
R1401:Spta1 UTSW 1 174222684 missense probably damaging 1.00
R1489:Spta1 UTSW 1 174231325 missense probably damaging 0.97
R1532:Spta1 UTSW 1 174247353 missense probably damaging 0.99
R1551:Spta1 UTSW 1 174240166 missense possibly damaging 0.94
R1555:Spta1 UTSW 1 174178749 missense probably damaging 0.99
R1566:Spta1 UTSW 1 174184706 missense probably benign 0.00
R1586:Spta1 UTSW 1 174213495 missense probably benign 0.00
R1676:Spta1 UTSW 1 174179839 missense probably damaging 0.98
R1711:Spta1 UTSW 1 174241042 missense probably damaging 1.00
R1795:Spta1 UTSW 1 174245730 missense probably damaging 1.00
R1823:Spta1 UTSW 1 174246549 missense probably benign 0.05
R1842:Spta1 UTSW 1 174195947 missense probably benign 0.00
R1867:Spta1 UTSW 1 174219839 missense probably benign 0.33
R1970:Spta1 UTSW 1 174240367 missense possibly damaging 0.88
R2042:Spta1 UTSW 1 174211647 missense probably benign 0.20
R2095:Spta1 UTSW 1 174244198 missense possibly damaging 0.75
R2125:Spta1 UTSW 1 174208344 missense possibly damaging 0.80
R2145:Spta1 UTSW 1 174212614 missense probably benign 0.00
R2158:Spta1 UTSW 1 174229258 missense probably benign 0.41
R2187:Spta1 UTSW 1 174192966 missense probably damaging 1.00
R2250:Spta1 UTSW 1 174244114 missense probably damaging 1.00
R2258:Spta1 UTSW 1 174174341 missense possibly damaging 0.76
R2319:Spta1 UTSW 1 174178656 critical splice acceptor site probably null
R3782:Spta1 UTSW 1 174208314 missense probably damaging 1.00
R4058:Spta1 UTSW 1 174241137 missense probably damaging 1.00
R4080:Spta1 UTSW 1 174214066 missense probably benign 0.00
R4081:Spta1 UTSW 1 174214066 missense probably benign 0.00
R4082:Spta1 UTSW 1 174214066 missense probably benign 0.00
R4108:Spta1 UTSW 1 174174556 missense probably benign 0.01
R4115:Spta1 UTSW 1 174240357 missense probably damaging 1.00
R4303:Spta1 UTSW 1 174179852 missense probably damaging 1.00
R4419:Spta1 UTSW 1 174247424 nonsense probably null
R4525:Spta1 UTSW 1 174207110 missense probably null 1.00
R4614:Spta1 UTSW 1 174192977 missense probably damaging 1.00
R4673:Spta1 UTSW 1 174191062 splice site probably null
R4782:Spta1 UTSW 1 174230666 missense probably benign 0.01
R4825:Spta1 UTSW 1 174244042 critical splice acceptor site probably null
R4829:Spta1 UTSW 1 174237927 missense probably benign 0.01
R4873:Spta1 UTSW 1 174175830 missense probably damaging 1.00
R4875:Spta1 UTSW 1 174175830 missense probably damaging 1.00
R4898:Spta1 UTSW 1 174237834 missense possibly damaging 0.94
R4910:Spta1 UTSW 1 174217863 splice site probably null
R4911:Spta1 UTSW 1 174185647 missense probably damaging 1.00
R4928:Spta1 UTSW 1 174191056 missense probably benign 0.15
R4959:Spta1 UTSW 1 174246608 missense probably damaging 0.97
R5009:Spta1 UTSW 1 174240223 missense possibly damaging 0.62
R5149:Spta1 UTSW 1 174247434 missense probably damaging 0.99
R5293:Spta1 UTSW 1 174195985 missense probably damaging 0.99
R5421:Spta1 UTSW 1 174215529 missense probably damaging 0.99
R5457:Spta1 UTSW 1 174217193 missense probably damaging 1.00
R5590:Spta1 UTSW 1 174175770 missense possibly damaging 0.73
R5606:Spta1 UTSW 1 174219902 missense probably damaging 1.00
R5736:Spta1 UTSW 1 174214255 critical splice donor site probably null
R5834:Spta1 UTSW 1 174184797 intron probably null
R5845:Spta1 UTSW 1 174241096 missense probably damaging 0.97
R5987:Spta1 UTSW 1 174223328 missense probably damaging 1.00
R6102:Spta1 UTSW 1 174224520 missense probably benign 0.01
R6221:Spta1 UTSW 1 174181776 missense probably damaging 1.00
R6276:Spta1 UTSW 1 174218512 missense probably damaging 1.00
R6317:Spta1 UTSW 1 174241087 missense probably damaging 1.00
R6329:Spta1 UTSW 1 174214177 missense possibly damaging 0.60
R6352:Spta1 UTSW 1 174211646 missense possibly damaging 0.94
R6374:Spta1 UTSW 1 174214168 missense probably damaging 1.00
R6376:Spta1 UTSW 1 174203322 missense probably benign
R6387:Spta1 UTSW 1 174231333 missense probably benign 0.01
R6451:Spta1 UTSW 1 174217201 missense probably damaging 0.97
R6480:Spta1 UTSW 1 174187148 intron probably null
R6585:Spta1 UTSW 1 174178685 missense probably damaging 1.00
R6695:Spta1 UTSW 1 174244042 critical splice acceptor site probably null
R6945:Spta1 UTSW 1 174209325 missense possibly damaging 0.89
R7020:Spta1 UTSW 1 174209352 missense probably damaging 1.00
R7086:Spta1 UTSW 1 174199484 missense probably damaging 0.98
R7087:Spta1 UTSW 1 174174510 missense probably benign
R7151:Spta1 UTSW 1 174197751 missense probably damaging 1.00
T0722:Spta1 UTSW 1 174191066 splice site probably benign
X0028:Spta1 UTSW 1 174224450 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGAGTTCCAGGATGACAACC -3'
(R):5'- AACGGAACATCTCTGTAAGTGCTC -3'

Sequencing Primer
(F):5'- TCATCTCACAGCTGTTTTTCAAAGGG -3'
(R):5'- AAGTGCTCTTTATCAGGTGCC -3'
Posted On2018-06-06