Incidental Mutation 'R6456:Ddx28'
ID520186
Institutional Source Beutler Lab
Gene Symbol Ddx28
Ensembl Gene ENSMUSG00000045538
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 28
Synonyms2410004K13Rik, Mddx28
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.914) question?
Stock #R6456 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location106009621-106011882 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 106010368 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 353 (I353F)
Ref Sequence ENSEMBL: ENSMUSP00000058950 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034375] [ENSMUST00000058579] [ENSMUST00000119736] [ENSMUST00000142898] [ENSMUST00000227778]
Predicted Effect probably benign
Transcript: ENSMUST00000034375
SMART Domains Protein: ENSMUSP00000034375
Gene: ENSMUSG00000031901

DomainStartEndE-ValueType
Pfam:Dus 15 344 1.8e-54 PFAM
DSRM 370 435 1.03e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000058579
AA Change: I353F

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000058950
Gene: ENSMUSG00000045538
AA Change: I353F

DomainStartEndE-ValueType
low complexity region 8 18 N/A INTRINSIC
low complexity region 42 58 N/A INTRINSIC
DEXDc 147 365 1.64e-40 SMART
HELICc 411 492 6.89e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119736
SMART Domains Protein: ENSMUSP00000113781
Gene: ENSMUSG00000031901

DomainStartEndE-ValueType
Pfam:Dus 1 233 8.1e-38 PFAM
DSRM 257 322 1.03e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141374
Predicted Effect probably benign
Transcript: ENSMUST00000142898
Predicted Effect probably benign
Transcript: ENSMUST00000227778
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure, such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of the DEAD box protein family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene is intronless. It encodes an RNA-dependent ATPase. The encoded protein is localized in the mitochondria and the nucleus, and can be transported between the mitochondria and the nucleus. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T A 1: 26,685,169 H310L probably damaging Het
9930021J03Rik G A 19: 29,716,514 P1860S possibly damaging Het
Abca13 A T 11: 9,290,474 H779L possibly damaging Het
Abca7 T C 10: 80,015,150 V2097A probably null Het
Adam8 A G 7: 139,986,788 S524P possibly damaging Het
Anapc2 T C 2: 25,280,195 M575T probably damaging Het
Arhgap42 T A 9: 9,005,822 I736L probably benign Het
AU040320 A G 4: 126,842,491 N789S probably benign Het
Bmi1 A G 2: 18,682,247 Y46C probably damaging Het
Ccdc125 T C 13: 100,696,309 S465P possibly damaging Het
Cd180 C T 13: 102,702,836 L76F probably damaging Het
Cep135 T C 5: 76,591,724 probably benign Het
Col6a5 G A 9: 105,945,477 T227I unknown Het
Cyp4a29 G T 4: 115,251,184 M368I probably benign Het
Ddx58 T A 4: 40,213,838 N607Y possibly damaging Het
Dhx40 G A 11: 86,784,974 T198M probably damaging Het
Fam71f1 A G 6: 29,334,046 N299S probably benign Het
Fat4 G A 3: 38,983,979 V3927M possibly damaging Het
Gm10226 G T 17: 21,692,025 G56* probably null Het
Gm11127 A T 17: 36,056,610 Y279N probably damaging Het
Itsn2 T G 12: 4,629,923 probably benign Het
Lrrc8a A G 2: 30,255,474 D100G probably benign Het
Madd T C 2: 91,178,191 H122R probably benign Het
Mfsd4b3 C G 10: 39,947,320 V315L probably benign Het
Mki67 C G 7: 135,699,475 A1277P possibly damaging Het
Nlrp9b T A 7: 20,048,778 N872K probably damaging Het
Npas1 T C 7: 16,461,926 T274A probably benign Het
Nrm A T 17: 35,865,400 probably null Het
Olfr418 A T 1: 173,270,538 D121V probably damaging Het
Pdilt T A 7: 119,500,483 L187F probably damaging Het
Pkdcc T C 17: 83,220,119 I242T probably damaging Het
Plch2 C A 4: 154,993,002 D535Y probably damaging Het
Pmpca T A 2: 26,395,167 I468N probably damaging Het
Prpf4 T C 4: 62,414,632 probably null Het
Rcc1 A G 4: 132,334,116 S361P probably benign Het
Rnf213 A G 11: 119,459,966 I3876V probably benign Het
Sall2 T A 14: 52,313,593 Q715L probably damaging Het
Sall2 G A 14: 52,313,594 Q713* probably null Het
Sin3a A G 9: 57,113,701 S1004G possibly damaging Het
Sltm C T 9: 70,542,987 T23M probably damaging Het
Sspo A G 6: 48,451,806 E385G probably benign Het
Syne3 G T 12: 104,940,704 R775S possibly damaging Het
Szt2 A T 4: 118,376,697 probably benign Het
Tlk2 T C 11: 105,221,273 S151P probably benign Het
Trabd2b C T 4: 114,586,560 R305C probably damaging Het
Ttc21b T C 2: 66,188,331 Q1244R probably damaging Het
Vmn2r125 A G 4: 156,351,062 N245S probably benign Het
Wdr34 T C 2: 30,032,767 S323G probably benign Het
Wdr64 G A 1: 175,785,609 probably null Het
Wdr70 G A 15: 7,885,637 T550M possibly damaging Het
Wdr78 A C 4: 103,049,549 M689R probably benign Het
Other mutations in Ddx28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01314:Ddx28 APN 8 106010580 missense probably damaging 0.97
R0166:Ddx28 UTSW 8 106010289 missense probably benign 0.00
R0329:Ddx28 UTSW 8 106010245 missense probably benign 0.00
R0362:Ddx28 UTSW 8 106011294 missense probably damaging 0.99
R0464:Ddx28 UTSW 8 106010053 missense probably damaging 1.00
R1267:Ddx28 UTSW 8 106009917 missense probably damaging 1.00
R1686:Ddx28 UTSW 8 106010558 missense probably damaging 1.00
R1748:Ddx28 UTSW 8 106010682 missense probably benign 0.01
R2201:Ddx28 UTSW 8 106010574 missense probably damaging 1.00
R4005:Ddx28 UTSW 8 106010928 missense possibly damaging 0.80
R6601:Ddx28 UTSW 8 106010616 unclassified probably null
R7295:Ddx28 UTSW 8 106010844 missense probably benign
R7320:Ddx28 UTSW 8 106011325 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CAGAATGTACCCAAGCCAGTTC -3'
(R):5'- TGCTAGATGAAGTAGACACACTG -3'

Sequencing Primer
(F):5'- TACCCAAGCCAGTTCACGGTG -3'
(R):5'- CACTGCTAGATGAAAGCTTCCTGG -3'
Posted On2018-06-06