Incidental Mutation 'R6533:Tacc2'
ID520189
Institutional Source Beutler Lab
Gene Symbol Tacc2
Ensembl Gene ENSMUSG00000030852
Gene Nametransforming, acidic coiled-coil containing protein 2
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6533 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location130577438-130764785 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 130622837 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 417 (E417D)
Ref Sequence ENSEMBL: ENSMUSP00000146419 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059145] [ENSMUST00000084513] [ENSMUST00000124096] [ENSMUST00000207789] [ENSMUST00000207918] [ENSMUST00000208722] [ENSMUST00000215492]
Predicted Effect probably benign
Transcript: ENSMUST00000059145
SMART Domains Protein: ENSMUSP00000061242
Gene: ENSMUSG00000030852

DomainStartEndE-ValueType
low complexity region 87 102 N/A INTRINSIC
low complexity region 147 173 N/A INTRINSIC
internal_repeat_1 181 291 2.03e-5 PROSPERO
low complexity region 345 356 N/A INTRINSIC
internal_repeat_1 483 566 2.03e-5 PROSPERO
low complexity region 571 586 N/A INTRINSIC
low complexity region 603 614 N/A INTRINSIC
low complexity region 648 662 N/A INTRINSIC
coiled coil region 873 900 N/A INTRINSIC
Pfam:TACC 939 1145 4e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000084513
AA Change: E417D

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000081561
Gene: ENSMUSG00000030852
AA Change: E417D

DomainStartEndE-ValueType
internal_repeat_1 19 346 3.83e-6 PROSPERO
low complexity region 398 410 N/A INTRINSIC
low complexity region 413 431 N/A INTRINSIC
internal_repeat_1 778 1068 3.83e-6 PROSPERO
low complexity region 1397 1415 N/A INTRINSIC
low complexity region 1723 1739 N/A INTRINSIC
low complexity region 1794 1809 N/A INTRINSIC
low complexity region 1854 1880 N/A INTRINSIC
low complexity region 2052 2063 N/A INTRINSIC
low complexity region 2278 2293 N/A INTRINSIC
low complexity region 2310 2321 N/A INTRINSIC
low complexity region 2355 2369 N/A INTRINSIC
coiled coil region 2606 2633 N/A INTRINSIC
Pfam:TACC 2673 2873 6.1e-87 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124096
SMART Domains Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
Pfam:Pkinase 1 118 4.8e-19 PFAM
Pfam:Pkinase_Tyr 1 118 1.7e-50 PFAM
low complexity region 146 160 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000207789
Predicted Effect possibly damaging
Transcript: ENSMUST00000207918
AA Change: E417D

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207999
Predicted Effect probably benign
Transcript: ENSMUST00000208722
Predicted Effect possibly damaging
Transcript: ENSMUST00000215492
AA Change: E436D

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: This gene encodes a member of the transforming, acidic coiled-coil (TACC) family of proteins. Members of this family are centrosomal proteins that interact with microtubules and tubulin. TACC proteins are thought to be involved in centrosome/mitotic spindle dynamics and gene regulation. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are healthy and fertile and do not display any increase in tumorigenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010B08Rik C T 2: 173,719,835 probably benign Het
4932414N04Rik G T 2: 68,716,318 E115* probably null Het
Abhd16a G A 17: 35,098,809 probably null Het
Ankrd28 T A 14: 31,732,084 I244L possibly damaging Het
Barx2 T C 9: 31,912,979 Y38C probably damaging Het
Btn2a2 C A 13: 23,481,781 E294* probably null Het
Ceacam2 C G 7: 25,530,711 V157L probably benign Het
Ces2c T A 8: 104,852,093 F334L possibly damaging Het
Col7a1 T C 9: 108,961,358 I958T unknown Het
Cyhr1 C A 15: 76,647,730 E283* probably null Het
Dcp2 T A 18: 44,399,664 D82E probably benign Het
Dnah8 T C 17: 30,746,990 L2432S probably damaging Het
Dst A G 1: 34,303,509 D7582G probably benign Het
Fat3 T A 9: 15,998,899 I1936L probably benign Het
Gsdmc4 T A 15: 63,892,060 N396I probably damaging Het
Lonrf2 A C 1: 38,813,268 D167E probably benign Het
Marf1 T C 16: 14,115,799 D1575G probably benign Het
Med23 T C 10: 24,893,620 L101P probably damaging Het
Myh3 A G 11: 67,090,419 I703V probably damaging Het
Ncan G A 8: 70,096,357 A1257V probably benign Het
Nipal4 A T 11: 46,150,407 Y320* probably null Het
Obox5 A T 7: 15,757,607 Q24L probably benign Het
Orc1 T C 4: 108,597,447 S345P probably benign Het
P4hb A T 11: 120,571,643 I79N probably damaging Het
Phf3 A T 1: 30,806,318 I1262N probably damaging Het
Pigo A T 4: 43,022,697 N291K probably benign Het
Ppargc1b C T 18: 61,307,774 R691H possibly damaging Het
Ppm1m T C 9: 106,196,870 probably benign Het
Ptprd A T 4: 76,128,528 D500E probably damaging Het
Rab3gap2 T A 1: 185,232,954 probably null Het
Rnf214 A G 9: 45,900,063 S101P probably benign Het
Sdhc A G 1: 171,129,827 S162P possibly damaging Het
Spta1 C T 1: 174,244,147 T2231I probably damaging Het
Stxbp2 T A 8: 3,642,683 D578E probably benign Het
Tas2r144 A T 6: 42,215,346 N7Y probably benign Het
Tasp1 A G 2: 139,834,357 *421R probably null Het
Tigd5 A G 15: 75,910,190 I134V possibly damaging Het
Tmem95 A T 11: 69,878,017 M1K probably null Het
Trappc10 T C 10: 78,188,894 M1134V probably damaging Het
Unc45a T G 7: 80,334,069 K326N probably damaging Het
Vmn1r59 A G 7: 5,454,464 V99A probably benign Het
Vmn2r4 T C 3: 64,415,098 T67A probably benign Het
Vmn2r85 A T 10: 130,426,660 M70K probably benign Het
Zkscan8 A G 13: 21,520,578 F325S probably damaging Het
Other mutations in Tacc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00836:Tacc2 APN 7 130759168 missense probably damaging 1.00
IGL01396:Tacc2 APN 7 130759189 missense probably damaging 0.98
IGL01621:Tacc2 APN 7 130729768 missense probably damaging 0.99
IGL02000:Tacc2 APN 7 130729168 unclassified probably null
IGL02075:Tacc2 APN 7 130728852 missense probably benign 0.03
IGL02201:Tacc2 APN 7 130626212 missense possibly damaging 0.84
IGL02205:Tacc2 APN 7 130626682 missense probably damaging 1.00
IGL02399:Tacc2 APN 7 130623399 missense probably benign 0.15
IGL02456:Tacc2 APN 7 130626261 missense probably benign 0.35
IGL02559:Tacc2 APN 7 130759267 missense probably damaging 1.00
IGL02734:Tacc2 APN 7 130626099 missense probably damaging 0.98
IGL02800:Tacc2 APN 7 130624079 missense probably benign 0.40
IGL02938:Tacc2 APN 7 130728941 missense probably damaging 1.00
IGL03031:Tacc2 APN 7 130623855 missense possibly damaging 0.94
IGL03278:Tacc2 APN 7 130733568 critical splice donor site probably null
IGL03283:Tacc2 APN 7 130742266 missense possibly damaging 0.47
IGL03371:Tacc2 APN 7 130626061 missense possibly damaging 0.90
R0002:Tacc2 UTSW 7 130621785 missense probably damaging 0.99
R0119:Tacc2 UTSW 7 130621875 missense probably damaging 0.98
R0244:Tacc2 UTSW 7 130751825 splice site probably benign
R0619:Tacc2 UTSW 7 130716753 missense probably damaging 1.00
R0624:Tacc2 UTSW 7 130577509 missense probably damaging 0.99
R0632:Tacc2 UTSW 7 130625595 nonsense probably null
R1015:Tacc2 UTSW 7 130624065 missense probably benign
R1081:Tacc2 UTSW 7 130728574 missense possibly damaging 0.46
R1086:Tacc2 UTSW 7 130626497 missense possibly damaging 0.94
R1351:Tacc2 UTSW 7 130663003 intron probably benign
R1538:Tacc2 UTSW 7 130625419 missense probably benign 0.03
R1743:Tacc2 UTSW 7 130626598 nonsense probably null
R1771:Tacc2 UTSW 7 130742240 missense probably damaging 1.00
R1876:Tacc2 UTSW 7 130623745 missense probably benign 0.38
R1893:Tacc2 UTSW 7 130625325 missense probably benign 0.01
R1899:Tacc2 UTSW 7 130624202 missense possibly damaging 0.81
R2005:Tacc2 UTSW 7 130731550 missense probably damaging 1.00
R2131:Tacc2 UTSW 7 130621857 missense possibly damaging 0.90
R2338:Tacc2 UTSW 7 130733569 splice site probably null
R2407:Tacc2 UTSW 7 130622040 missense possibly damaging 0.65
R3051:Tacc2 UTSW 7 130625496 missense possibly damaging 0.81
R3052:Tacc2 UTSW 7 130625496 missense possibly damaging 0.81
R3053:Tacc2 UTSW 7 130625496 missense possibly damaging 0.81
R3116:Tacc2 UTSW 7 130759249 missense probably damaging 1.00
R3412:Tacc2 UTSW 7 130734994 missense probably benign 0.02
R3683:Tacc2 UTSW 7 130625070 missense probably benign 0.40
R3685:Tacc2 UTSW 7 130625070 missense probably benign 0.40
R3872:Tacc2 UTSW 7 130622422 missense probably benign 0.02
R4063:Tacc2 UTSW 7 130729122 missense probably damaging 0.97
R4410:Tacc2 UTSW 7 130742211 missense possibly damaging 0.80
R4434:Tacc2 UTSW 7 130623541 missense probably damaging 0.96
R4438:Tacc2 UTSW 7 130623541 missense probably damaging 0.96
R4618:Tacc2 UTSW 7 130626216 missense probably benign 0.10
R4674:Tacc2 UTSW 7 130624861 missense possibly damaging 0.75
R4742:Tacc2 UTSW 7 130625967 missense probably benign 0.00
R4934:Tacc2 UTSW 7 130728588 missense probably damaging 1.00
R4947:Tacc2 UTSW 7 130625899 missense probably damaging 0.98
R4964:Tacc2 UTSW 7 130728777 missense probably damaging 1.00
R4966:Tacc2 UTSW 7 130728777 missense probably damaging 1.00
R4967:Tacc2 UTSW 7 130623948 missense probably damaging 0.99
R5052:Tacc2 UTSW 7 130735014 missense probably damaging 1.00
R5276:Tacc2 UTSW 7 130729317 missense probably damaging 1.00
R5330:Tacc2 UTSW 7 130733528 missense probably damaging 1.00
R5331:Tacc2 UTSW 7 130733528 missense probably damaging 1.00
R5372:Tacc2 UTSW 7 130623260 missense probably benign 0.09
R5556:Tacc2 UTSW 7 130674606 missense probably damaging 0.97
R5645:Tacc2 UTSW 7 130624051 missense possibly damaging 0.80
R5886:Tacc2 UTSW 7 130729120 missense probably benign 0.18
R5996:Tacc2 UTSW 7 130623483 missense probably damaging 0.96
R6074:Tacc2 UTSW 7 130625435 missense possibly damaging 0.92
R6127:Tacc2 UTSW 7 130626115 missense possibly damaging 0.92
R6156:Tacc2 UTSW 7 130625764 missense probably damaging 0.98
R6298:Tacc2 UTSW 7 130626525 missense probably benign 0.26
R6444:Tacc2 UTSW 7 130623412 missense possibly damaging 0.46
R6724:Tacc2 UTSW 7 130728762 missense probably damaging 1.00
X0010:Tacc2 UTSW 7 130735057 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGAAAGAGACTCTGGACACC -3'
(R):5'- GGACTGTATCATTTTGCCCCTG -3'

Sequencing Primer
(F):5'- GACACCAGCGATGCTCAGAG -3'
(R):5'- TGCCCCTGCAAGAAAGGTG -3'
Posted On2018-06-06