Incidental Mutation 'R6456:Arhgap42'
ID520190
Institutional Source Beutler Lab
Gene Symbol Arhgap42
Ensembl Gene ENSMUSG00000050730
Gene NameRho GTPase activating protein 42
Synonyms9030420J04Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.888) question?
Stock #R6456 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location8994329-9239101 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 9005822 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 736 (I736L)
Ref Sequence ENSEMBL: ENSMUSP00000091419 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093893]
Predicted Effect probably benign
Transcript: ENSMUST00000093893
AA Change: I736L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000091419
Gene: ENSMUSG00000050730
AA Change: I736L

DomainStartEndE-ValueType
Pfam:BAR_3 6 132 4.4e-36 PFAM
Pfam:BAR_3 125 215 8.9e-29 PFAM
PH 232 342 5.5e-8 SMART
RhoGAP 358 535 1.4e-55 SMART
low complexity region 583 596 N/A INTRINSIC
low complexity region 599 616 N/A INTRINSIC
Blast:RhoGAP 617 691 2e-37 BLAST
low complexity region 692 711 N/A INTRINSIC
SH3 786 840 7.4e-12 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a hypomorphic allele exhibit hypertension and increased vascular smooth muscle contractility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T A 1: 26,685,169 H310L probably damaging Het
9930021J03Rik G A 19: 29,716,514 P1860S possibly damaging Het
Abca13 A T 11: 9,290,474 H779L possibly damaging Het
Abca7 T C 10: 80,015,150 V2097A probably null Het
Adam8 A G 7: 139,986,788 S524P possibly damaging Het
Anapc2 T C 2: 25,280,195 M575T probably damaging Het
AU040320 A G 4: 126,842,491 N789S probably benign Het
Bmi1 A G 2: 18,682,247 Y46C probably damaging Het
Ccdc125 T C 13: 100,696,309 S465P possibly damaging Het
Cd180 C T 13: 102,702,836 L76F probably damaging Het
Cep135 T C 5: 76,591,724 probably benign Het
Col6a5 G A 9: 105,945,477 T227I unknown Het
Cyp4a29 G T 4: 115,251,184 M368I probably benign Het
Ddx28 T A 8: 106,010,368 I353F possibly damaging Het
Ddx58 T A 4: 40,213,838 N607Y possibly damaging Het
Dhx40 G A 11: 86,784,974 T198M probably damaging Het
Fam71f1 A G 6: 29,334,046 N299S probably benign Het
Fat4 G A 3: 38,983,979 V3927M possibly damaging Het
Gm10226 G T 17: 21,692,025 G56* probably null Het
Gm11127 A T 17: 36,056,610 Y279N probably damaging Het
Itsn2 T G 12: 4,629,923 probably benign Het
Lrrc8a A G 2: 30,255,474 D100G probably benign Het
Madd T C 2: 91,178,191 H122R probably benign Het
Mfsd4b3 C G 10: 39,947,320 V315L probably benign Het
Mki67 C G 7: 135,699,475 A1277P possibly damaging Het
Nlrp9b T A 7: 20,048,778 N872K probably damaging Het
Npas1 T C 7: 16,461,926 T274A probably benign Het
Nrm A T 17: 35,865,400 probably null Het
Olfr418 A T 1: 173,270,538 D121V probably damaging Het
Pdilt T A 7: 119,500,483 L187F probably damaging Het
Pkdcc T C 17: 83,220,119 I242T probably damaging Het
Plch2 C A 4: 154,993,002 D535Y probably damaging Het
Pmpca T A 2: 26,395,167 I468N probably damaging Het
Prpf4 T C 4: 62,414,632 probably null Het
Rcc1 A G 4: 132,334,116 S361P probably benign Het
Rnf213 A G 11: 119,459,966 I3876V probably benign Het
Sall2 T A 14: 52,313,593 Q715L probably damaging Het
Sall2 G A 14: 52,313,594 Q713* probably null Het
Sin3a A G 9: 57,113,701 S1004G possibly damaging Het
Sltm C T 9: 70,542,987 T23M probably damaging Het
Sspo A G 6: 48,451,806 E385G probably benign Het
Syne3 G T 12: 104,940,704 R775S possibly damaging Het
Szt2 A T 4: 118,376,697 probably benign Het
Tlk2 T C 11: 105,221,273 S151P probably benign Het
Trabd2b C T 4: 114,586,560 R305C probably damaging Het
Ttc21b T C 2: 66,188,331 Q1244R probably damaging Het
Vmn2r125 A G 4: 156,351,062 N245S probably benign Het
Wdr34 T C 2: 30,032,767 S323G probably benign Het
Wdr64 G A 1: 175,785,609 probably null Het
Wdr70 G A 15: 7,885,637 T550M possibly damaging Het
Wdr78 A C 4: 103,049,549 M689R probably benign Het
Other mutations in Arhgap42
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00476:Arhgap42 APN 9 9006343 missense probably damaging 1.00
IGL00576:Arhgap42 APN 9 8997620 nonsense probably null
IGL01693:Arhgap42 APN 9 9006506 missense probably damaging 1.00
IGL01724:Arhgap42 APN 9 8998253 splice site probably benign
IGL02142:Arhgap42 APN 9 9155359 missense probably damaging 1.00
IGL02378:Arhgap42 APN 9 9035583 missense possibly damaging 0.94
IGL02932:Arhgap42 APN 9 9115708 missense probably damaging 0.98
IGL02992:Arhgap42 APN 9 8998248 splice site probably benign
IGL03149:Arhgap42 APN 9 9008084 missense possibly damaging 0.71
R0096:Arhgap42 UTSW 9 9009313 missense probably damaging 1.00
R0096:Arhgap42 UTSW 9 9009313 missense probably damaging 1.00
R0417:Arhgap42 UTSW 9 9180033 missense possibly damaging 0.55
R0513:Arhgap42 UTSW 9 9005765 missense probably benign 0.07
R1212:Arhgap42 UTSW 9 9015312 missense probably damaging 1.00
R1493:Arhgap42 UTSW 9 9030797 missense probably benign 0.01
R1499:Arhgap42 UTSW 9 9033586 splice site probably benign
R1674:Arhgap42 UTSW 9 9006584 missense probably damaging 0.99
R1687:Arhgap42 UTSW 9 9035537 missense probably benign 0.33
R1808:Arhgap42 UTSW 9 9180050 missense probably damaging 0.99
R1983:Arhgap42 UTSW 9 9017017 missense probably damaging 1.00
R2069:Arhgap42 UTSW 9 9035600 missense probably damaging 1.00
R2276:Arhgap42 UTSW 9 9035511 missense probably benign
R2279:Arhgap42 UTSW 9 9035511 missense probably benign
R2295:Arhgap42 UTSW 9 9115744 missense probably damaging 0.99
R3807:Arhgap42 UTSW 9 9008033 missense probably damaging 0.98
R4133:Arhgap42 UTSW 9 9011299 intron probably benign
R4304:Arhgap42 UTSW 9 9006488 missense probably benign
R4530:Arhgap42 UTSW 9 9011432 missense probably damaging 1.00
R4532:Arhgap42 UTSW 9 9011432 missense probably damaging 1.00
R4786:Arhgap42 UTSW 9 9238698 nonsense probably null
R4807:Arhgap42 UTSW 9 9046628 missense possibly damaging 0.70
R4809:Arhgap42 UTSW 9 9180117 missense probably damaging 0.99
R4999:Arhgap42 UTSW 9 9009434 missense probably damaging 1.00
R5160:Arhgap42 UTSW 9 8997655 missense probably damaging 0.97
R5737:Arhgap42 UTSW 9 9059068 missense probably damaging 0.98
R5840:Arhgap42 UTSW 9 9046517 missense possibly damaging 0.94
R6172:Arhgap42 UTSW 9 9148245 missense possibly damaging 0.71
R6782:Arhgap42 UTSW 9 9115720 missense probably damaging 0.99
R6846:Arhgap42 UTSW 9 9006445 missense probably damaging 1.00
X0066:Arhgap42 UTSW 9 9115700 missense probably damaging 1.00
X0066:Arhgap42 UTSW 9 9115704 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGACCATTTAACTATAGAACCCC -3'
(R):5'- TAAGTGATGGACTGCCGTACC -3'

Sequencing Primer
(F):5'- GAACCCCCAAATTCTTCTAGTACAG -3'
(R):5'- GACTGCCGTACCCAAATTACATTCTG -3'
Posted On2018-06-06