Incidental Mutation 'R6456:Nrm'
ID520226
Institutional Source Beutler Lab
Gene Symbol Nrm
Ensembl Gene ENSMUSG00000059791
Gene Namenurim (nuclear envelope membrane protein)
Synonyms2610307M02Rik
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.710) question?
Stock #R6456 (G1)
Quality Score204.009
Status Not validated
Chromosome17
Chromosomal Location35861318-35865402 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 35865400 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000073873 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074259] [ENSMUST00000113814] [ENSMUST00000122899] [ENSMUST00000127442] [ENSMUST00000144382] [ENSMUST00000174873] [ENSMUST00000187690] [ENSMUST00000190496]
Predicted Effect probably null
Transcript: ENSMUST00000074259
SMART Domains Protein: ENSMUSP00000073873
Gene: ENSMUSG00000059791

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
transmembrane domain 59 81 N/A INTRINSIC
transmembrane domain 94 116 N/A INTRINSIC
transmembrane domain 136 158 N/A INTRINSIC
low complexity region 212 234 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113814
SMART Domains Protein: ENSMUSP00000109445
Gene: ENSMUSG00000034595

DomainStartEndE-ValueType
Pfam:Phostensin_N 28 117 1.3e-42 PFAM
low complexity region 138 154 N/A INTRINSIC
low complexity region 353 365 N/A INTRINSIC
Pfam:Phostensin 417 541 7.7e-49 PFAM
low complexity region 560 573 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122899
SMART Domains Protein: ENSMUSP00000120343
Gene: ENSMUSG00000034595

DomainStartEndE-ValueType
Pfam:Phostensin_N 28 117 1.3e-42 PFAM
low complexity region 138 154 N/A INTRINSIC
low complexity region 353 365 N/A INTRINSIC
Pfam:Phostensin 417 541 7.7e-49 PFAM
low complexity region 560 573 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127442
SMART Domains Protein: ENSMUSP00000115753
Gene: ENSMUSG00000034595

DomainStartEndE-ValueType
Pfam:Phostensin_N 27 117 1.5e-39 PFAM
low complexity region 138 154 N/A INTRINSIC
low complexity region 353 365 N/A INTRINSIC
Pfam:Phostensin 417 540 6.9e-34 PFAM
low complexity region 560 573 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144382
SMART Domains Protein: ENSMUSP00000116100
Gene: ENSMUSG00000034595

DomainStartEndE-ValueType
Pfam:Phostensin_N 28 117 1.3e-42 PFAM
low complexity region 138 154 N/A INTRINSIC
low complexity region 353 365 N/A INTRINSIC
Pfam:Phostensin 417 541 7.7e-49 PFAM
low complexity region 560 573 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145804
Predicted Effect probably benign
Transcript: ENSMUST00000172931
SMART Domains Protein: ENSMUSP00000134569
Gene: ENSMUSG00000059791

DomainStartEndE-ValueType
transmembrane domain 37 59 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174873
SMART Domains Protein: ENSMUSP00000133355
Gene: ENSMUSG00000059791

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184224
Predicted Effect probably benign
Transcript: ENSMUST00000187690
SMART Domains Protein: ENSMUSP00000141094
Gene: ENSMUSG00000034595

DomainStartEndE-ValueType
Pfam:Phostensin_N 28 117 1.3e-42 PFAM
low complexity region 138 154 N/A INTRINSIC
low complexity region 353 365 N/A INTRINSIC
Pfam:Phostensin 417 541 7.7e-49 PFAM
low complexity region 560 573 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190496
SMART Domains Protein: ENSMUSP00000140652
Gene: ENSMUSG00000034595

DomainStartEndE-ValueType
Pfam:Phostensin 1 113 3.6e-43 PFAM
low complexity region 132 145 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains transmembrane domains and resides within the inner nuclear membrane, where it is tightly associated with the nucleus. This protein shares homology with isoprenylcysteine carboxymethyltransferase enzymes. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T A 1: 26,685,169 H310L probably damaging Het
9930021J03Rik G A 19: 29,716,514 P1860S possibly damaging Het
Abca13 A T 11: 9,290,474 H779L possibly damaging Het
Abca7 T C 10: 80,015,150 V2097A probably null Het
Adam8 A G 7: 139,986,788 S524P possibly damaging Het
Anapc2 T C 2: 25,280,195 M575T probably damaging Het
Arhgap42 T A 9: 9,005,822 I736L probably benign Het
AU040320 A G 4: 126,842,491 N789S probably benign Het
Bmi1 A G 2: 18,682,247 Y46C probably damaging Het
Ccdc125 T C 13: 100,696,309 S465P possibly damaging Het
Cd180 C T 13: 102,702,836 L76F probably damaging Het
Cep135 T C 5: 76,591,724 probably benign Het
Col6a5 G A 9: 105,945,477 T227I unknown Het
Cyp4a29 G T 4: 115,251,184 M368I probably benign Het
Ddx28 T A 8: 106,010,368 I353F possibly damaging Het
Ddx58 T A 4: 40,213,838 N607Y possibly damaging Het
Dhx40 G A 11: 86,784,974 T198M probably damaging Het
Fam71f1 A G 6: 29,334,046 N299S probably benign Het
Fat4 G A 3: 38,983,979 V3927M possibly damaging Het
Gm10226 G T 17: 21,692,025 G56* probably null Het
Gm11127 A T 17: 36,056,610 Y279N probably damaging Het
Itsn2 T G 12: 4,629,923 probably benign Het
Lrrc8a A G 2: 30,255,474 D100G probably benign Het
Madd T C 2: 91,178,191 H122R probably benign Het
Mfsd4b3 C G 10: 39,947,320 V315L probably benign Het
Mki67 C G 7: 135,699,475 A1277P possibly damaging Het
Nlrp9b T A 7: 20,048,778 N872K probably damaging Het
Npas1 T C 7: 16,461,926 T274A probably benign Het
Olfr418 A T 1: 173,270,538 D121V probably damaging Het
Pdilt T A 7: 119,500,483 L187F probably damaging Het
Pkdcc T C 17: 83,220,119 I242T probably damaging Het
Plch2 C A 4: 154,993,002 D535Y probably damaging Het
Pmpca T A 2: 26,395,167 I468N probably damaging Het
Prpf4 T C 4: 62,414,632 probably null Het
Rcc1 A G 4: 132,334,116 S361P probably benign Het
Rnf213 A G 11: 119,459,966 I3876V probably benign Het
Sall2 T A 14: 52,313,593 Q715L probably damaging Het
Sall2 G A 14: 52,313,594 Q713* probably null Het
Sin3a A G 9: 57,113,701 S1004G possibly damaging Het
Sltm C T 9: 70,542,987 T23M probably damaging Het
Sspo A G 6: 48,451,806 E385G probably benign Het
Syne3 G T 12: 104,940,704 R775S possibly damaging Het
Szt2 A T 4: 118,376,697 probably benign Het
Tlk2 T C 11: 105,221,273 S151P probably benign Het
Trabd2b C T 4: 114,586,560 R305C probably damaging Het
Ttc21b T C 2: 66,188,331 Q1244R probably damaging Het
Vmn2r125 A G 4: 156,351,062 N245S probably benign Het
Wdr34 T C 2: 30,032,767 S323G probably benign Het
Wdr64 G A 1: 175,785,609 probably null Het
Wdr70 G A 15: 7,885,637 T550M possibly damaging Het
Wdr78 A C 4: 103,049,549 M689R probably benign Het
Other mutations in Nrm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00869:Nrm APN 17 35864755 missense probably benign 0.06
IGL02511:Nrm APN 17 35861424 missense probably damaging 1.00
R0211:Nrm UTSW 17 35864611 missense probably damaging 1.00
R0557:Nrm UTSW 17 35864632 missense probably damaging 1.00
R0602:Nrm UTSW 17 35864264 nonsense probably null
R0635:Nrm UTSW 17 35864264 nonsense probably null
R1571:Nrm UTSW 17 35864187 missense probably damaging 1.00
R2046:Nrm UTSW 17 35864217 missense probably benign 0.00
R4073:Nrm UTSW 17 35861532 splice site probably benign
R4612:Nrm UTSW 17 35863529 missense probably benign 0.00
R4828:Nrm UTSW 17 35864190 missense possibly damaging 0.72
R6038:Nrm UTSW 17 35861505 missense possibly damaging 0.83
R6322:Nrm UTSW 17 35864713 missense possibly damaging 0.73
R7345:Nrm UTSW 17 35864584 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGTGGCTCTTTTGTACCGC -3'
(R):5'- AGAGTTATTCTGTCTCCCGTGG -3'

Sequencing Primer
(F):5'- TACCGCGGCTGTGCTTC -3'
(R):5'- GTTCCCTGATTTATACGCGGAGAAAC -3'
Posted On2018-06-06