Incidental Mutation 'R6533:Marf1'
ID520231
Institutional Source Beutler Lab
Gene Symbol Marf1
Ensembl Gene ENSMUSG00000060657
Gene Namemeiosis regulator and mRNA stability 1
Synonyms4921513D23Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.194) question?
Stock #R6533 (G1)
Quality Score222.009
Status Validated
Chromosome16
Chromosomal Location14109173-14163351 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 14115799 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1575 (D1575G)
Ref Sequence ENSEMBL: ENSMUSP00000087770 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090300]
Predicted Effect probably benign
Transcript: ENSMUST00000090300
AA Change: D1575G

PolyPhen 2 Score 0.156 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000087770
Gene: ENSMUSG00000060657
AA Change: D1575G

DomainStartEndE-ValueType
low complexity region 116 127 N/A INTRINSIC
low complexity region 290 305 N/A INTRINSIC
Pfam:NYN 351 492 1.5e-21 PFAM
RRM 511 579 3.17e-1 SMART
low complexity region 599 610 N/A INTRINSIC
RRM 790 864 4.47e-3 SMART
internal_repeat_2 871 914 1.57e-5 PROSPERO
low complexity region 944 960 N/A INTRINSIC
Pfam:OST-HTH 1096 1167 1e-11 PFAM
low complexity region 1181 1186 N/A INTRINSIC
Pfam:OST-HTH 1256 1328 1.2e-10 PFAM
Pfam:OST-HTH 1332 1404 2.4e-10 PFAM
Pfam:OST-HTH 1408 1480 6.8e-13 PFAM
Pfam:OST-HTH 1483 1555 3e-14 PFAM
low complexity region 1682 1701 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a putative peroxisomal protein that appears to be conserved across Euteleostomi. In humans, it may be autoantigenic. [provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit female infertility with abnormalities in oogenic processes including meiotic progression, genomic integrity and acquisition of developmental competence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010B08Rik C T 2: 173,719,835 probably benign Het
4932414N04Rik G T 2: 68,716,318 E115* probably null Het
Abhd16a G A 17: 35,098,809 probably null Het
Ankrd28 T A 14: 31,732,084 I244L possibly damaging Het
Barx2 T C 9: 31,912,979 Y38C probably damaging Het
Btn2a2 C A 13: 23,481,781 E294* probably null Het
Ceacam2 C G 7: 25,530,711 V157L probably benign Het
Ces2c T A 8: 104,852,093 F334L possibly damaging Het
Col7a1 T C 9: 108,961,358 I958T unknown Het
Cyhr1 C A 15: 76,647,730 E283* probably null Het
Dcp2 T A 18: 44,399,664 D82E probably benign Het
Dnah8 T C 17: 30,746,990 L2432S probably damaging Het
Dst A G 1: 34,303,509 D7582G probably benign Het
Fat3 T A 9: 15,998,899 I1936L probably benign Het
Gsdmc4 T A 15: 63,892,060 N396I probably damaging Het
Lonrf2 A C 1: 38,813,268 D167E probably benign Het
Med23 T C 10: 24,893,620 L101P probably damaging Het
Myh3 A G 11: 67,090,419 I703V probably damaging Het
Ncan G A 8: 70,096,357 A1257V probably benign Het
Nipal4 A T 11: 46,150,407 Y320* probably null Het
Obox5 A T 7: 15,757,607 Q24L probably benign Het
Orc1 T C 4: 108,597,447 S345P probably benign Het
P4hb A T 11: 120,571,643 I79N probably damaging Het
Phf3 A T 1: 30,806,318 I1262N probably damaging Het
Pigo A T 4: 43,022,697 N291K probably benign Het
Ppargc1b C T 18: 61,307,774 R691H possibly damaging Het
Ppm1m T C 9: 106,196,870 probably benign Het
Ptprd A T 4: 76,128,528 D500E probably damaging Het
Rab3gap2 T A 1: 185,232,954 probably null Het
Rnf214 A G 9: 45,900,063 S101P probably benign Het
Sdhc A G 1: 171,129,827 S162P possibly damaging Het
Spta1 C T 1: 174,244,147 T2231I probably damaging Het
Stxbp2 T A 8: 3,642,683 D578E probably benign Het
Tacc2 A T 7: 130,622,837 E417D possibly damaging Het
Tas2r144 A T 6: 42,215,346 N7Y probably benign Het
Tasp1 A G 2: 139,834,357 *421R probably null Het
Tigd5 A G 15: 75,910,190 I134V possibly damaging Het
Tmem95 A T 11: 69,878,017 M1K probably null Het
Trappc10 T C 10: 78,188,894 M1134V probably damaging Het
Unc45a T G 7: 80,334,069 K326N probably damaging Het
Vmn1r59 A G 7: 5,454,464 V99A probably benign Het
Vmn2r4 T C 3: 64,415,098 T67A probably benign Het
Vmn2r85 A T 10: 130,426,660 M70K probably benign Het
Zkscan8 A G 13: 21,520,578 F325S probably damaging Het
Other mutations in Marf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00517:Marf1 APN 16 14115742 missense possibly damaging 0.49
IGL00933:Marf1 APN 16 14117357 missense probably damaging 1.00
IGL01101:Marf1 APN 16 14146736 missense possibly damaging 0.85
IGL02140:Marf1 APN 16 14141912 missense probably damaging 0.99
IGL03196:Marf1 APN 16 14140259 missense possibly damaging 0.64
PIT4283001:Marf1 UTSW 16 14128568 missense probably benign 0.22
R0016:Marf1 UTSW 16 14152265 missense probably damaging 0.99
R0016:Marf1 UTSW 16 14152265 missense probably damaging 0.99
R0046:Marf1 UTSW 16 14111727 missense possibly damaging 0.83
R0046:Marf1 UTSW 16 14111727 missense possibly damaging 0.83
R0056:Marf1 UTSW 16 14142534 missense probably damaging 1.00
R0057:Marf1 UTSW 16 14142534 missense probably damaging 1.00
R0058:Marf1 UTSW 16 14142534 missense probably damaging 1.00
R0058:Marf1 UTSW 16 14142534 missense probably damaging 1.00
R0113:Marf1 UTSW 16 14142534 missense probably damaging 1.00
R0115:Marf1 UTSW 16 14142534 missense probably damaging 1.00
R0179:Marf1 UTSW 16 14151176 missense probably damaging 1.00
R0238:Marf1 UTSW 16 14151283 missense probably benign 0.00
R0238:Marf1 UTSW 16 14151283 missense probably benign 0.00
R0294:Marf1 UTSW 16 14142534 missense probably damaging 1.00
R0295:Marf1 UTSW 16 14142534 missense probably damaging 1.00
R0316:Marf1 UTSW 16 14142534 missense probably damaging 1.00
R0318:Marf1 UTSW 16 14142534 missense probably damaging 1.00
R0375:Marf1 UTSW 16 14151320 splice site probably benign
R0383:Marf1 UTSW 16 14142534 missense probably damaging 1.00
R0391:Marf1 UTSW 16 14142534 missense probably damaging 1.00
R0504:Marf1 UTSW 16 14142534 missense probably damaging 1.00
R0589:Marf1 UTSW 16 14142055 splice site probably benign
R0603:Marf1 UTSW 16 14142534 missense probably damaging 1.00
R0610:Marf1 UTSW 16 14142534 missense probably damaging 1.00
R1240:Marf1 UTSW 16 14146762 missense possibly damaging 0.48
R1445:Marf1 UTSW 16 14115824 missense probably benign
R1716:Marf1 UTSW 16 14142586 missense possibly damaging 0.95
R1921:Marf1 UTSW 16 14128601 missense possibly damaging 0.63
R2098:Marf1 UTSW 16 14114200 missense probably benign 0.00
R2155:Marf1 UTSW 16 14132429 missense probably damaging 0.99
R2177:Marf1 UTSW 16 14152607 missense probably benign 0.01
R2195:Marf1 UTSW 16 14111699 missense probably benign
R2410:Marf1 UTSW 16 14115827 missense probably benign 0.02
R2999:Marf1 UTSW 16 14142641 missense possibly damaging 0.60
R3000:Marf1 UTSW 16 14142641 missense possibly damaging 0.60
R3147:Marf1 UTSW 16 14125979 missense possibly damaging 0.64
R3148:Marf1 UTSW 16 14125979 missense possibly damaging 0.64
R3430:Marf1 UTSW 16 14140177 unclassified probably benign
R3821:Marf1 UTSW 16 14142554 missense probably damaging 1.00
R4383:Marf1 UTSW 16 14142641 missense possibly damaging 0.60
R4384:Marf1 UTSW 16 14142641 missense possibly damaging 0.60
R4520:Marf1 UTSW 16 14132666 missense probably damaging 0.98
R4554:Marf1 UTSW 16 14153977 start gained probably benign
R4557:Marf1 UTSW 16 14153977 start gained probably benign
R4768:Marf1 UTSW 16 14131597 missense possibly damaging 0.93
R4784:Marf1 UTSW 16 14152457 missense probably benign
R4857:Marf1 UTSW 16 14128611 nonsense probably null
R4863:Marf1 UTSW 16 14132665 missense possibly damaging 0.60
R4994:Marf1 UTSW 16 14114231 missense probably benign
R5191:Marf1 UTSW 16 14146078 missense probably damaging 1.00
R5503:Marf1 UTSW 16 14152231 missense probably damaging 0.99
R5813:Marf1 UTSW 16 14152585 missense probably benign 0.35
R5905:Marf1 UTSW 16 14127249 missense probably damaging 0.99
R5960:Marf1 UTSW 16 14152417 missense probably damaging 0.98
R6104:Marf1 UTSW 16 14117455 missense probably damaging 0.99
R6387:Marf1 UTSW 16 14141640 makesense probably null
R6608:Marf1 UTSW 16 14132714 missense probably damaging 1.00
R6642:Marf1 UTSW 16 14132747 missense probably benign 0.02
R6954:Marf1 UTSW 16 14138520 missense probably damaging 1.00
R6994:Marf1 UTSW 16 14128857 missense probably damaging 1.00
R7010:Marf1 UTSW 16 14137001 missense probably damaging 0.99
R7090:Marf1 UTSW 16 14111702 missense possibly damaging 0.52
R7174:Marf1 UTSW 16 14136953 missense probably damaging 1.00
R7221:Marf1 UTSW 16 14142485 missense probably damaging 1.00
R7247:Marf1 UTSW 16 14127093 missense probably damaging 1.00
U24488:Marf1 UTSW 16 14132366 nonsense probably null
X0025:Marf1 UTSW 16 14114278 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTTAATGAAATTGCCCACTGTCC -3'
(R):5'- ACCAGGAGTATGTCTTGTGTGC -3'

Sequencing Primer
(F):5'- AATGAAATTGCCCACTGTCCTTTTC -3'
(R):5'- TGACATGAAAAGTAAGTAAGCTCCC -3'
Posted On2018-06-06