Incidental Mutation 'R6534:Olfr74'
ID520253
Institutional Source Beutler Lab
Gene Symbol Olfr74
Ensembl Gene ENSMUSG00000075142
Gene Nameolfactory receptor 74
SynonymsMOR174-4, mOR-EV, GA_x6K02T2Q125-49458388-49457432
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock #R6534 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location87973707-87974663 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 87974041 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 208 (A208V)
Ref Sequence ENSEMBL: ENSMUSP00000097428 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099840]
Predicted Effect probably benign
Transcript: ENSMUST00000099840
AA Change: A208V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000097428
Gene: ENSMUSG00000075142
AA Change: A208V

DomainStartEndE-ValueType
Pfam:7tm_4 32 308 5.4e-47 PFAM
Pfam:7tm_1 42 291 2e-17 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acer3 A T 7: 98,226,448 L142M probably benign Het
Adgrb2 T C 4: 130,022,219 F1435L probably damaging Het
Anapc13 T C 9: 102,634,093 L60P probably damaging Het
Apaf1 T C 10: 91,056,000 D497G probably damaging Het
Arpc1b A T 5: 145,122,567 I34F probably damaging Het
Atp2a2 A T 5: 122,457,198 W1030R possibly damaging Het
Cdk5rap2 T C 4: 70,354,813 E241G probably damaging Het
Cyp4a14 T A 4: 115,489,959 probably null Het
Ddx10 A G 9: 53,223,688 Y399H probably damaging Het
Dnah9 T C 11: 65,955,248 E2988G probably damaging Het
Dock10 T C 1: 80,503,671 I536M probably benign Het
Drc7 T C 8: 95,071,282 Y443H probably damaging Het
Ecel1 A G 1: 87,154,842 S50P probably benign Het
Esco1 T A 18: 10,594,794 Q164L possibly damaging Het
Exosc7 A G 9: 123,132,012 D248G probably benign Het
Galnt3 A G 2: 66,102,531 L201P probably damaging Het
Hand2 C A 8: 57,322,036 H44N probably benign Het
Kcnq1 C T 7: 143,194,327 P411S probably benign Het
Lonp2 A G 8: 86,716,458 D429G probably benign Het
Magi3 A G 3: 104,085,220 I312T possibly damaging Het
Mansc4 A T 6: 147,086,873 I31N probably damaging Het
Mill2 T A 7: 18,856,596 D200E possibly damaging Het
Pde4d A G 13: 109,632,901 K41R probably benign Het
Pik3r5 G A 11: 68,490,617 D210N possibly damaging Het
Plcl1 C T 1: 55,696,748 T416I probably damaging Het
Plekhd1 T C 12: 80,707,257 Y166H probably damaging Het
Prrc1 A G 18: 57,389,274 T393A probably damaging Het
Scaper A T 9: 55,883,976 C213S probably benign Het
Sfxn4 T C 19: 60,839,023 I298V probably damaging Het
Slc36a2 A T 11: 55,184,867 D31E probably benign Het
Stra6l G A 4: 45,860,041 probably null Het
Tnpo3 A T 6: 29,572,703 probably null Het
Tonsl A G 15: 76,629,677 Y1231H probably damaging Het
Ush2a C A 1: 188,451,802 Y1434* probably null Het
Zfp69 T C 4: 120,931,197 Y307C probably benign Het
Other mutations in Olfr74
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01545:Olfr74 APN 2 87974551 missense probably benign 0.27
IGL02119:Olfr74 APN 2 87974410 missense probably benign 0.38
IGL02332:Olfr74 APN 2 87974065 missense probably damaging 1.00
IGL02626:Olfr74 APN 2 87973724 missense probably benign
IGL03022:Olfr74 APN 2 87973997 missense probably benign 0.00
R1015:Olfr74 UTSW 2 87974087 missense probably benign 0.03
R1908:Olfr74 UTSW 2 87974059 missense possibly damaging 0.66
R2358:Olfr74 UTSW 2 87973722 missense probably benign 0.02
R3711:Olfr74 UTSW 2 87973722 missense probably benign 0.02
R4646:Olfr74 UTSW 2 87973798 missense probably benign 0.18
R4807:Olfr74 UTSW 2 87973751 missense probably benign 0.00
R5026:Olfr74 UTSW 2 87974020 missense probably damaging 1.00
R5928:Olfr74 UTSW 2 87974036 missense probably benign 0.06
R6010:Olfr74 UTSW 2 87974542 missense probably damaging 0.98
R6243:Olfr74 UTSW 2 87974587 missense probably benign 0.00
R6848:Olfr74 UTSW 2 87974170 missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- GGAATTCTTAGAGTTGGGCACAC -3'
(R):5'- TAGCCATGTCCCAGAAACTCTG -3'

Sequencing Primer
(F):5'- CAGGTGGAGAAAGCCTTA -3'
(R):5'- CAGAAACTCTGTATCACACTGGTGG -3'
Posted On2018-06-06