Incidental Mutation 'R6473:Zfp157'
ID520334
Institutional Source Beutler Lab
Gene Symbol Zfp157
Ensembl Gene ENSMUSG00000036898
Gene Namezinc finger protein 157
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R6473 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location138441468-138460694 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 138455926 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 129 (C129R)
Ref Sequence ENSEMBL: ENSMUSP00000083018 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085856] [ENSMUST00000100524] [ENSMUST00000110912]
Predicted Effect probably damaging
Transcript: ENSMUST00000085856
AA Change: C129R

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000083018
Gene: ENSMUSG00000036898
AA Change: C129R

DomainStartEndE-ValueType
KRAB 4 64 3.64e-35 SMART
ZnF_C2H2 183 205 3.69e-4 SMART
ZnF_C2H2 211 233 3.16e-3 SMART
ZnF_C2H2 239 261 3.63e-3 SMART
ZnF_C2H2 267 289 2.24e-3 SMART
ZnF_C2H2 295 317 1.47e-3 SMART
ZnF_C2H2 323 345 1.95e-3 SMART
ZnF_C2H2 351 373 1.28e-3 SMART
ZnF_C2H2 379 401 2.4e-3 SMART
ZnF_C2H2 407 429 9.73e-4 SMART
ZnF_C2H2 435 457 4.4e-2 SMART
ZnF_C2H2 463 485 1.01e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100524
SMART Domains Protein: ENSMUSP00000098093
Gene: ENSMUSG00000036898

DomainStartEndE-ValueType
KRAB 4 64 3.64e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110912
SMART Domains Protein: ENSMUSP00000106537
Gene: ENSMUSG00000036898

DomainStartEndE-ValueType
KRAB 4 64 3.64e-35 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 96.9%
  • 20x: 89.9%
Validation Efficiency 95% (36/38)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele display accelerated ductal elongation during puberty and accelerated alveologenesis during pregnancy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts1 T C 16: 85,799,643 D106G probably damaging Het
Adat3 A G 10: 80,606,967 D213G probably damaging Het
Akt1 T C 12: 112,662,260 D32G probably damaging Het
Ampd1 C T 3: 103,095,646 R61* probably null Het
Ash2l T A 8: 25,834,980 T184S probably damaging Het
B3galnt1 T C 3: 69,575,340 N196S possibly damaging Het
Chmp2b C T 16: 65,546,872 G96S probably damaging Het
Cyp2d26 T C 15: 82,791,767 N248S probably benign Het
Cyp46a1 G T 12: 108,355,475 R320L possibly damaging Het
Dact1 A G 12: 71,317,698 T418A probably benign Het
Ddx3y T C Y: 1,265,971 Y342C possibly damaging Homo
Dnm3 T A 1: 162,477,705 Q40L probably damaging Het
Eif2s1 T C 12: 78,881,225 I225T probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Eps8 A T 6: 137,479,098 I795N probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fbxw7 T C 3: 84,952,380 probably benign Het
Gba C T 3: 89,204,081 P51L probably benign Het
Idh3b AG AGCACCACAACTG 2: 130,279,673 probably null Het
Kalrn A G 16: 34,205,302 I551T probably damaging Het
Madd T C 2: 91,167,059 T755A probably benign Het
Mrps31 A G 8: 22,414,865 D90G probably benign Het
Olfr115 T A 17: 37,609,996 T252S possibly damaging Het
Olfr191 A T 16: 59,086,043 L147M probably benign Het
P2ry12 T A 3: 59,217,511 I248F probably benign Het
Ptgfrn T C 3: 101,045,639 R760G probably damaging Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Homo
Slpi T C 2: 164,354,926 Y116C probably damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Terb1 T A 8: 104,473,037 E425V probably damaging Het
Thbs2 A G 17: 14,685,796 S281P probably benign Het
Tnik A G 3: 28,263,643 M1V probably null Het
Usp16 G A 16: 87,483,135 S741N probably benign Het
Usp48 T C 4: 137,609,108 probably null Het
Vipr1 T C 9: 121,668,555 S380P probably damaging Het
Vmn1r21 A T 6: 57,843,598 I287K probably damaging Het
Other mutations in Zfp157
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01322:Zfp157 APN 5 138447578 missense probably benign 0.02
IGL02377:Zfp157 APN 5 138447597 nonsense probably null
R1476:Zfp157 UTSW 5 138455095 critical splice donor site probably null
R1883:Zfp157 UTSW 5 138444840 missense probably damaging 1.00
R1884:Zfp157 UTSW 5 138444840 missense probably damaging 1.00
R3401:Zfp157 UTSW 5 138457011 missense probably benign 0.35
R4237:Zfp157 UTSW 5 138447541 missense probably damaging 1.00
R4239:Zfp157 UTSW 5 138447541 missense probably damaging 1.00
R4573:Zfp157 UTSW 5 138456929 missense probably damaging 0.97
R4785:Zfp157 UTSW 5 138444789 missense probably damaging 1.00
R4914:Zfp157 UTSW 5 138456295 missense possibly damaging 0.85
R5476:Zfp157 UTSW 5 138457181 missense possibly damaging 0.92
R6128:Zfp157 UTSW 5 138455019 missense possibly damaging 0.95
R6572:Zfp157 UTSW 5 138457051 missense possibly damaging 0.92
R6990:Zfp157 UTSW 5 138456510 nonsense probably null
Z1088:Zfp157 UTSW 5 138457199 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTTAAGTAACAAGATGCACAGCAGG -3'
(R):5'- TCTGATTTGGAGGAGAAAGCTTTC -3'

Sequencing Primer
(F):5'- CAGGGAAAATTGTGAGTGTACTTCC -3'
(R):5'- GGAGAAAGCTTTCTTGCATTCTGTAC -3'
Posted On2018-06-06