Incidental Mutation 'R6535:Apobec3'
List |< first << previous [record 56 of 958] next >> last >|
ID520355
Institutional Source Beutler Lab
Gene Symbol Apobec3
Ensembl Gene ENSMUSG00000009585
Gene Nameapolipoprotein B mRNA editing enzyme, catalytic polypeptide 3
SynonymsRfv3, Gm20117, CEM15, Rfv-3
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6535 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location79891659-79915906 bp(+) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) A to G at 79897749 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Tryptophan at position 47 (*47W)
Ref Sequence ENSEMBL: ENSMUSP00000135507 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023054] [ENSMUST00000109620] [ENSMUST00000165537] [ENSMUST00000175714] [ENSMUST00000175752] [ENSMUST00000176325] [ENSMUST00000176868] [ENSMUST00000176904] [ENSMUST00000177006] [ENSMUST00000177098] [ENSMUST00000177350] [ENSMUST00000177483] [ENSMUST00000230135] [ENSMUST00000230741]
Predicted Effect probably benign
Transcript: ENSMUST00000023054
SMART Domains Protein: ENSMUSP00000023054
Gene: ENSMUSG00000009585

DomainStartEndE-ValueType
Pfam:APOBEC_N 1 99 6.5e-22 PFAM
Pfam:APOBEC_C 37 91 2.8e-23 PFAM
Pfam:APOBEC_N 106 276 4.4e-28 PFAM
Pfam:APOBEC_C 215 268 1.5e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000109620
AA Change: K86E

PolyPhen 2 Score 0.863 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000105249
Gene: ENSMUSG00000009585
AA Change: K86E

DomainStartEndE-ValueType
Pfam:APOBEC_N 21 198 6.5e-37 PFAM
Pfam:APOBEC_C 136 190 4.9e-23 PFAM
low complexity region 203 213 N/A INTRINSIC
Pfam:APOBEC_N 238 408 1.1e-27 PFAM
Pfam:APOBEC_C 347 400 2.5e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165537
AA Change: K86E

PolyPhen 2 Score 0.407 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000132391
Gene: ENSMUSG00000009585
AA Change: K86E

DomainStartEndE-ValueType
Pfam:APOBEC_N 21 198 5.4e-37 PFAM
Pfam:APOBEC_C 136 190 4.3e-23 PFAM
Pfam:APOBEC_N 205 375 9e-28 PFAM
Pfam:APOBEC_C 314 367 2.3e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000175714
AA Change: K97E

PolyPhen 2 Score 0.338 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000135027
Gene: ENSMUSG00000009585
AA Change: K97E

DomainStartEndE-ValueType
Pfam:APOBEC_N 37 206 1.1e-57 PFAM
Pfam:APOBEC_C 148 199 2e-22 PFAM
low complexity region 214 224 N/A INTRINSIC
Pfam:APOBEC_N 253 416 7.6e-33 PFAM
Pfam:APOBEC_C 359 409 3.7e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000175752
AA Change: K97E

PolyPhen 2 Score 0.082 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000135358
Gene: ENSMUSG00000009585
AA Change: K97E

DomainStartEndE-ValueType
Pfam:APOBEC_N 32 209 7.9e-37 PFAM
Pfam:APOBEC_C 147 201 6.3e-23 PFAM
Pfam:APOBEC_N 216 386 1.3e-27 PFAM
Pfam:APOBEC_C 325 378 3.3e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175801
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175849
Predicted Effect possibly damaging
Transcript: ENSMUST00000176325
AA Change: K97E

PolyPhen 2 Score 0.691 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000134838
Gene: ENSMUSG00000009585
AA Change: K97E

DomainStartEndE-ValueType
Pfam:APOBEC_N 32 209 9e-37 PFAM
Pfam:APOBEC_C 147 201 6.8e-23 PFAM
low complexity region 214 224 N/A INTRINSIC
Pfam:APOBEC_N 249 419 1.5e-27 PFAM
Pfam:APOBEC_C 358 411 3.6e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176644
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176823
Predicted Effect probably null
Transcript: ENSMUST00000176868
AA Change: *80W
Predicted Effect probably benign
Transcript: ENSMUST00000176904
SMART Domains Protein: ENSMUSP00000135502
Gene: ENSMUSG00000009585

DomainStartEndE-ValueType
Pfam:APOBEC_N 1 84 7.4e-21 PFAM
Pfam:APOBEC_C 37 85 2.7e-22 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000177006
AA Change: *47W
Predicted Effect probably benign
Transcript: ENSMUST00000177098
AA Change: K97E

PolyPhen 2 Score 0.072 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000135079
Gene: ENSMUSG00000009585
AA Change: K97E

DomainStartEndE-ValueType
Pfam:APOBEC_N 31 209 6.8e-37 PFAM
Pfam:APOBEC_C 147 201 6e-23 PFAM
Pfam:APOBEC_N 216 386 1.2e-27 PFAM
Pfam:APOBEC_C 325 378 3.1e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177350
SMART Domains Protein: ENSMUSP00000134938
Gene: ENSMUSG00000009585

DomainStartEndE-ValueType
Pfam:APOBEC_N 1 99 1.6e-22 PFAM
Pfam:APOBEC_C 37 91 9.8e-24 PFAM
low complexity region 104 114 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177483
SMART Domains Protein: ENSMUSP00000135011
Gene: ENSMUSG00000009585

DomainStartEndE-ValueType
Pfam:APOBEC_N 1 99 1.3e-22 PFAM
Pfam:APOBEC_C 37 91 8.1e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000230135
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230175
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230410
Predicted Effect probably benign
Transcript: ENSMUST00000230741
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the cytidine deaminase gene family. It is one of seven related genes or pseudogenes found in a cluster, thought to result from gene duplication, on chromosome 22. Members of the cluster encode proteins that are structurally and functionally related to the C to U RNA-editing cytidine deaminase APOBEC1. It is thought that the proteins may be RNA editing enzymes and have roles in growth or cell cycle control. A hybrid gene results from the deletion of approximately 29.5 kb of sequence between this gene, APOBEC3B, and the adjacent gene APOBEC3A. The breakpoints of the deletion are within the two genes, so the deletion allele is predicted to have the promoter and coding region of APOBEC3A, but the 3' UTR of APOBEC3B. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a gene trapped allele display more rapid and extensive spread of viral infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf5 G A 17: 43,440,029 S495N probably benign Het
Ank3 G T 10: 69,877,854 A448S probably damaging Het
B4gat1 T C 19: 5,039,530 V185A possibly damaging Het
Cers1 T A 8: 70,330,154 V58D probably damaging Het
Chrm1 T A 19: 8,679,073 Y381N possibly damaging Het
Cpne6 A T 14: 55,513,665 E177V probably benign Het
Cpt1a T A 19: 3,365,788 probably null Het
Ctsq A T 13: 61,035,326 I334N probably damaging Het
D730001G18Rik T C 15: 74,772,225 S81G probably damaging Het
Dennd6b A G 15: 89,186,367 L400P probably damaging Het
Fam135b A G 15: 71,622,075 S2P probably damaging Het
Gm20767 T C 13: 120,154,654 S10P probably damaging Het
Hip1 T C 5: 135,428,497 probably null Het
Lama2 A C 10: 27,104,131 L1896R probably damaging Het
Macf1 A T 4: 123,471,935 V3011D possibly damaging Het
Macrod1 A G 19: 7,057,147 D86G probably damaging Het
Mettl8 G T 2: 70,973,389 H185N possibly damaging Het
Mipol1 A C 12: 57,306,100 Q75P possibly damaging Het
Pi4ka C T 16: 17,301,036 V125M probably damaging Het
Pole A C 5: 110,324,807 Y1618S probably damaging Het
Prrc2a A G 17: 35,162,265 V21A unknown Het
Rhbdl1 A T 17: 25,835,825 Y111* probably null Het
Sbk3 A C 7: 4,969,841 M110R possibly damaging Het
Scn8a G A 15: 100,959,707 probably benign Het
Tshz3 T C 7: 36,768,789 S68P probably damaging Het
Vmn1r88 C T 7: 13,178,185 T156I probably benign Het
Wrn T C 8: 33,336,103 H177R probably damaging Het
Other mutations in Apobec3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02529:Apobec3 APN 15 79897687
R1863:Apobec3 UTSW 15 79897867 missense possibly damaging 0.58
R1885:Apobec3 UTSW 15 79897705 missense probably damaging 1.00
R3815:Apobec3 UTSW 15 79899100 missense possibly damaging 0.95
R4175:Apobec3 UTSW 15 79895452 missense probably damaging 1.00
R4677:Apobec3 UTSW 15 79895512 missense probably damaging 0.99
R4780:Apobec3 UTSW 15 79899024 missense possibly damaging 0.84
R5540:Apobec3 UTSW 15 79897919 missense probably benign 0.01
R5830:Apobec3 UTSW 15 79899067 missense possibly damaging 0.84
R5945:Apobec3 UTSW 15 79897846 missense probably damaging 1.00
X0066:Apobec3 UTSW 15 79905524 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATGCCCTGAATGCTGAGGG -3'
(R):5'- TATAGGTCCATGGCAGCCAC -3'

Sequencing Primer
(F):5'- CCTGAATGCTGAGGGACACG -3'
(R):5'- AGCCTGCAAAGATTCTGCTG -3'
Posted On2018-06-06