Incidental Mutation 'R6473:Cyp46a1'
ID520358
Institutional Source Beutler Lab
Gene Symbol Cyp46a1
Ensembl Gene ENSMUSG00000021259
Gene Namecytochrome P450, family 46, subfamily a, polypeptide 1
Synonymscholestrol 24-hydroxylase, Cyp46
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6473 (G1)
Quality Score106.008
Status Validated
Chromosome12
Chromosomal Location108334381-108362234 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 108355475 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 320 (R320L)
Ref Sequence ENSEMBL: ENSMUSP00000021684 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021684] [ENSMUST00000221708]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021684
AA Change: R320L

PolyPhen 2 Score 0.872 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000021684
Gene: ENSMUSG00000021259
AA Change: R320L

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
Pfam:p450 34 484 1.7e-86 PFAM
low complexity region 493 499 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000221708
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222240
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222902
Meta Mutation Damage Score 0.194 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 96.9%
  • 20x: 89.9%
Validation Efficiency 95% (36/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This endoplasmic reticulum protein is expressed in the brain, where it converts cholesterol to 24S-hydroxycholesterol. While cholesterol cannot pass the blood-brain barrier, 24S-hydroxycholesterol can be secreted in the brain into the circulation to be returned to the liver for catabolism. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygouse for deletions in this gene are essentially normal. Levels of 24(s)-hydroxycholesterol are reduced in serum and in the brain. Cholesterol synthesis in the brain is reduced 40%. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts1 T C 16: 85,799,643 D106G probably damaging Het
Adat3 A G 10: 80,606,967 D213G probably damaging Het
Akt1 T C 12: 112,662,260 D32G probably damaging Het
Ampd1 C T 3: 103,095,646 R61* probably null Het
Ash2l T A 8: 25,834,980 T184S probably damaging Het
B3galnt1 T C 3: 69,575,340 N196S possibly damaging Het
Chmp2b C T 16: 65,546,872 G96S probably damaging Het
Cyp2d26 T C 15: 82,791,767 N248S probably benign Het
Dact1 A G 12: 71,317,698 T418A probably benign Het
Ddx3y T C Y: 1,265,971 Y342C possibly damaging Homo
Dnm3 T A 1: 162,477,705 Q40L probably damaging Het
Eif2s1 T C 12: 78,881,225 I225T probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Eps8 A T 6: 137,479,098 I795N probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fbxw7 T C 3: 84,952,380 probably benign Het
Gba C T 3: 89,204,081 P51L probably benign Het
Idh3b AG AGCACCACAACTG 2: 130,279,673 probably null Het
Kalrn A G 16: 34,205,302 I551T probably damaging Het
Madd T C 2: 91,167,059 T755A probably benign Het
Mrps31 A G 8: 22,414,865 D90G probably benign Het
Olfr115 T A 17: 37,609,996 T252S possibly damaging Het
Olfr191 A T 16: 59,086,043 L147M probably benign Het
P2ry12 T A 3: 59,217,511 I248F probably benign Het
Ptgfrn T C 3: 101,045,639 R760G probably damaging Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Homo
Slpi T C 2: 164,354,926 Y116C probably damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Terb1 T A 8: 104,473,037 E425V probably damaging Het
Thbs2 A G 17: 14,685,796 S281P probably benign Het
Tnik A G 3: 28,263,643 M1V probably null Het
Usp16 G A 16: 87,483,135 S741N probably benign Het
Usp48 T C 4: 137,609,108 probably null Het
Vipr1 T C 9: 121,668,555 S380P probably damaging Het
Vmn1r21 A T 6: 57,843,598 I287K probably damaging Het
Zfp157 T C 5: 138,455,926 C129R probably damaging Het
Other mutations in Cyp46a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01622:Cyp46a1 APN 12 108351975 missense possibly damaging 0.78
IGL01623:Cyp46a1 APN 12 108351975 missense possibly damaging 0.78
IGL01804:Cyp46a1 APN 12 108355486 missense probably benign 0.44
IGL02069:Cyp46a1 APN 12 108346135 missense probably benign 0.18
IGL02900:Cyp46a1 APN 12 108343091 missense probably damaging 1.00
IGL02969:Cyp46a1 APN 12 108343037 missense probably damaging 1.00
PIT4651001:Cyp46a1 UTSW 12 108353108 missense probably benign 0.17
R0138:Cyp46a1 UTSW 12 108351211 missense probably damaging 1.00
R1572:Cyp46a1 UTSW 12 108351939 missense probably null 0.97
R1879:Cyp46a1 UTSW 12 108353126 missense probably damaging 1.00
R2280:Cyp46a1 UTSW 12 108355471 missense probably damaging 1.00
R3879:Cyp46a1 UTSW 12 108358130 missense probably benign 0.14
R4674:Cyp46a1 UTSW 12 108358086 missense probably damaging 1.00
R4717:Cyp46a1 UTSW 12 108352026 critical splice donor site probably null
R6224:Cyp46a1 UTSW 12 108361560 missense probably damaging 1.00
R6539:Cyp46a1 UTSW 12 108353157 splice site probably null
R7253:Cyp46a1 UTSW 12 108351996 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- GGTTATCACCCACTGGCTAG -3'
(R):5'- TGAGGCCTCTAGACCTGGAATC -3'

Sequencing Primer
(F):5'- GACCATCTCCTTCATATCACAGC -3'
(R):5'- GGCCTCTAGACCTGGAATCAAGTAC -3'
Posted On2018-06-06