Incidental Mutation 'R6473:Akt1'
ID520360
Institutional Source Beutler Lab
Gene Symbol Akt1
Ensembl Gene ENSMUSG00000001729
Gene Namethymoma viral proto-oncogene 1
SynonymsPKBalpha, PKB/Akt, Akt, PKB
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.943) question?
Stock #R6473 (G1)
Quality Score183.009
Status Validated
Chromosome12
Chromosomal Location112653821-112674884 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 112662260 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 32 (D32G)
Ref Sequence ENSEMBL: ENSMUSP00000118190 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001780] [ENSMUST00000128300] [ENSMUST00000130342] [ENSMUST00000144550]
Predicted Effect probably damaging
Transcript: ENSMUST00000001780
AA Change: D32G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000001780
Gene: ENSMUSG00000001729
AA Change: D32G

DomainStartEndE-ValueType
PH 6 110 2.41e-16 SMART
S_TKc 150 408 1.56e-107 SMART
S_TK_X 409 476 1.44e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123563
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127588
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127902
Predicted Effect possibly damaging
Transcript: ENSMUST00000128300
AA Change: D32G

PolyPhen 2 Score 0.753 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000122222
Gene: ENSMUSG00000001729
AA Change: D32G

DomainStartEndE-ValueType
PH 6 110 2.41e-16 SMART
Pfam:Pkinase 150 278 1e-31 PFAM
Pfam:Pkinase_Tyr 150 278 3.8e-13 PFAM
Pfam:Pkinase_Tyr 276 350 8.7e-6 PFAM
Pfam:Pkinase 277 365 5e-17 PFAM
S_TK_X 366 433 1.44e-19 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000130342
AA Change: D32G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000118190
Gene: ENSMUSG00000001729
AA Change: D32G

DomainStartEndE-ValueType
PH 6 110 2.41e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139388
Predicted Effect probably damaging
Transcript: ENSMUST00000144550
AA Change: D32G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000123689
Gene: ENSMUSG00000001729
AA Change: D32G

DomainStartEndE-ValueType
PH 6 110 2.41e-16 SMART
Pfam:Pkinase 150 202 2.6e-6 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184981
Meta Mutation Damage Score 0.406 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 96.9%
  • 20x: 89.9%
Validation Efficiency 95% (36/38)
MGI Phenotype FUNCTION: This gene encodes the founding member of the Akt serine-threonine protein kinase gene family that also includes Akt2 and Akt3. This kinase is a major downstream effector of the phosphatidylinositol 3-kinase (PI3K) pathway that mediates the effects of various growth factors such as platelet-derived growth factor (PDGF), epidermal growth factor (EGF), insulin and insulin-like growth factor I (IGF-I). It is activated through recruitment to cellular membranes by PI3K lipid products and by phosphorylation by 3-phosphoinositide dependent kinase-1. It then further phosphorylates different downstream proteins in response to various extracellular signals and thus plays a pivotal role in mediating a variety of cellular processes, such as glucose metabolism, glycogen biosynthesis, protein synthesis and turn over, inflammatory response, cell survival (anti-apoptosis) and development. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mutant homozygotes are smaller than sibs due to retarded prenatal and postnatal growth and exhibit increased apoptosis and decreased lifespan with genotoxic stress. Mice are fertile, but males have attenuated spermatogenesis and abnormal testes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts1 T C 16: 85,799,643 D106G probably damaging Het
Adat3 A G 10: 80,606,967 D213G probably damaging Het
Ampd1 C T 3: 103,095,646 R61* probably null Het
Ash2l T A 8: 25,834,980 T184S probably damaging Het
B3galnt1 T C 3: 69,575,340 N196S possibly damaging Het
Chmp2b C T 16: 65,546,872 G96S probably damaging Het
Cyp2d26 T C 15: 82,791,767 N248S probably benign Het
Cyp46a1 G T 12: 108,355,475 R320L possibly damaging Het
Dact1 A G 12: 71,317,698 T418A probably benign Het
Ddx3y T C Y: 1,265,971 Y342C possibly damaging Homo
Dnm3 T A 1: 162,477,705 Q40L probably damaging Het
Eif2s1 T C 12: 78,881,225 I225T probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Eps8 A T 6: 137,479,098 I795N probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fbxw7 T C 3: 84,952,380 probably benign Het
Gba C T 3: 89,204,081 P51L probably benign Het
Idh3b AG AGCACCACAACTG 2: 130,279,673 probably null Het
Kalrn A G 16: 34,205,302 I551T probably damaging Het
Madd T C 2: 91,167,059 T755A probably benign Het
Mrps31 A G 8: 22,414,865 D90G probably benign Het
Olfr115 T A 17: 37,609,996 T252S possibly damaging Het
Olfr191 A T 16: 59,086,043 L147M probably benign Het
P2ry12 T A 3: 59,217,511 I248F probably benign Het
Ptgfrn T C 3: 101,045,639 R760G probably damaging Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Homo
Slpi T C 2: 164,354,926 Y116C probably damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Terb1 T A 8: 104,473,037 E425V probably damaging Het
Thbs2 A G 17: 14,685,796 S281P probably benign Het
Tnik A G 3: 28,263,643 M1V probably null Het
Usp16 G A 16: 87,483,135 S741N probably benign Het
Usp48 T C 4: 137,609,108 probably null Het
Vipr1 T C 9: 121,668,555 S380P probably damaging Het
Vmn1r21 A T 6: 57,843,598 I287K probably damaging Het
Zfp157 T C 5: 138,455,926 C129R probably damaging Het
Other mutations in Akt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00786:Akt1 APN 12 112657671 missense probably damaging 1.00
IGL01779:Akt1 APN 12 112657169 missense probably damaging 1.00
IGL01886:Akt1 APN 12 112659158 missense probably benign 0.16
IGL02506:Akt1 APN 12 112659280 splice site probably benign
IGL02851:Akt1 APN 12 112657084 missense probably damaging 1.00
R0211:Akt1 UTSW 12 112655142 missense probably damaging 0.98
R0211:Akt1 UTSW 12 112655142 missense probably damaging 0.98
R1891:Akt1 UTSW 12 112659575 missense probably damaging 1.00
R1988:Akt1 UTSW 12 112655151 missense probably benign 0.02
R2018:Akt1 UTSW 12 112659625 missense probably damaging 0.99
R2019:Akt1 UTSW 12 112659625 missense probably damaging 0.99
R2023:Akt1 UTSW 12 112659637 missense probably benign 0.33
R3873:Akt1 UTSW 12 112656533 missense probably benign
R4446:Akt1 UTSW 12 112659133 missense probably benign 0.05
R4832:Akt1 UTSW 12 112657087 missense probably damaging 1.00
R5457:Akt1 UTSW 12 112657091 missense probably damaging 0.96
R5595:Akt1 UTSW 12 112658616 missense probably null 0.99
R5723:Akt1 UTSW 12 112657270 missense probably damaging 1.00
R5736:Akt1 UTSW 12 112656850 missense probably benign 0.12
R6058:Akt1 UTSW 12 112662200 missense probably damaging 0.99
R7045:Akt1 UTSW 12 112662301 nonsense probably null
R7129:Akt1 UTSW 12 112659649 missense probably benign 0.22
R7311:Akt1 UTSW 12 112657153 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGACTAACAGGAGGCTCTC -3'
(R):5'- AGAGCCCTAGATGATGCTCC -3'

Sequencing Primer
(F):5'- CTCCTCGGGTTTCTCAGTGG -3'
(R):5'- TAGATGATGCTCCCAGCTGCAG -3'
Posted On2018-06-06