Incidental Mutation 'R6473:Cyp2d26'
ID520364
Institutional Source Beutler Lab
Gene Symbol Cyp2d26
Ensembl Gene ENSMUSG00000022445
Gene Namecytochrome P450, family 2, subfamily d, polypeptide 26
Synonyms1300006E06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R6473 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location82790101-82794294 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 82791767 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 248 (N248S)
Ref Sequence ENSEMBL: ENSMUSP00000006094 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006094] [ENSMUST00000229387] [ENSMUST00000229512]
Predicted Effect probably benign
Transcript: ENSMUST00000006094
AA Change: N248S

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000006094
Gene: ENSMUSG00000022445
AA Change: N248S

DomainStartEndE-ValueType
transmembrane domain 10 27 N/A INTRINSIC
Pfam:p450 37 497 3.5e-141 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000229387
Predicted Effect probably benign
Transcript: ENSMUST00000229512
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230125
Meta Mutation Damage Score 0.0608 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 96.9%
  • 20x: 89.9%
Validation Efficiency 95% (36/38)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts1 T C 16: 85,799,643 D106G probably damaging Het
Adat3 A G 10: 80,606,967 D213G probably damaging Het
Akt1 T C 12: 112,662,260 D32G probably damaging Het
Ampd1 C T 3: 103,095,646 R61* probably null Het
Ash2l T A 8: 25,834,980 T184S probably damaging Het
B3galnt1 T C 3: 69,575,340 N196S possibly damaging Het
Chmp2b C T 16: 65,546,872 G96S probably damaging Het
Cyp46a1 G T 12: 108,355,475 R320L possibly damaging Het
Dact1 A G 12: 71,317,698 T418A probably benign Het
Ddx3y T C Y: 1,265,971 Y342C possibly damaging Homo
Dnm3 T A 1: 162,477,705 Q40L probably damaging Het
Eif2s1 T C 12: 78,881,225 I225T probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Eps8 A T 6: 137,479,098 I795N probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fbxw7 T C 3: 84,952,380 probably benign Het
Gba C T 3: 89,204,081 P51L probably benign Het
Idh3b AG AGCACCACAACTG 2: 130,279,673 probably null Het
Kalrn A G 16: 34,205,302 I551T probably damaging Het
Madd T C 2: 91,167,059 T755A probably benign Het
Mrps31 A G 8: 22,414,865 D90G probably benign Het
Olfr115 T A 17: 37,609,996 T252S possibly damaging Het
Olfr191 A T 16: 59,086,043 L147M probably benign Het
P2ry12 T A 3: 59,217,511 I248F probably benign Het
Ptgfrn T C 3: 101,045,639 R760G probably damaging Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Homo
Slpi T C 2: 164,354,926 Y116C probably damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Terb1 T A 8: 104,473,037 E425V probably damaging Het
Thbs2 A G 17: 14,685,796 S281P probably benign Het
Tnik A G 3: 28,263,643 M1V probably null Het
Usp16 G A 16: 87,483,135 S741N probably benign Het
Usp48 T C 4: 137,609,108 probably null Het
Vipr1 T C 9: 121,668,555 S380P probably damaging Het
Vmn1r21 A T 6: 57,843,598 I287K probably damaging Het
Zfp157 T C 5: 138,455,926 C129R probably damaging Het
Other mutations in Cyp2d26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00559:Cyp2d26 APN 15 82791043 missense probably benign 0.31
IGL00670:Cyp2d26 APN 15 82791741 missense probably benign
IGL01646:Cyp2d26 APN 15 82791418 missense probably benign 0.00
IGL01915:Cyp2d26 APN 15 82790249 missense probably benign 0.06
IGL01940:Cyp2d26 APN 15 82792557 missense probably benign 0.00
IGL02127:Cyp2d26 APN 15 82791106 missense probably benign 0.09
IGL02452:Cyp2d26 APN 15 82792626 missense probably benign 0.00
IGL03216:Cyp2d26 APN 15 82793261 missense probably benign
IGL03377:Cyp2d26 APN 15 82790554 missense possibly damaging 0.47
R0149:Cyp2d26 UTSW 15 82792767 missense probably damaging 1.00
R0848:Cyp2d26 UTSW 15 82790233 missense probably benign 0.00
R1165:Cyp2d26 UTSW 15 82794041 missense probably damaging 1.00
R1217:Cyp2d26 UTSW 15 82792867 splice site probably benign
R1780:Cyp2d26 UTSW 15 82794007 missense probably damaging 1.00
R2048:Cyp2d26 UTSW 15 82792727 utr 3 prime probably benign
R2152:Cyp2d26 UTSW 15 82792706 critical splice donor site probably null
R2397:Cyp2d26 UTSW 15 82794035 missense probably damaging 1.00
R4702:Cyp2d26 UTSW 15 82792447 intron probably benign
R5157:Cyp2d26 UTSW 15 82790989 missense probably benign 0.01
R5444:Cyp2d26 UTSW 15 82792538 missense probably benign 0.18
R6017:Cyp2d26 UTSW 15 82790573 missense possibly damaging 0.68
R6223:Cyp2d26 UTSW 15 82791717 missense probably benign 0.04
R6390:Cyp2d26 UTSW 15 82792624 missense possibly damaging 0.68
R6858:Cyp2d26 UTSW 15 82794083 missense probably damaging 1.00
R6912:Cyp2d26 UTSW 15 82791119 missense probably benign 0.16
R6936:Cyp2d26 UTSW 15 82792540 missense probably benign 0.14
R6960:Cyp2d26 UTSW 15 82790245 missense probably damaging 0.98
R7053:Cyp2d26 UTSW 15 82792600 missense probably benign 0.00
R7113:Cyp2d26 UTSW 15 82790202 missense probably benign 0.02
R7126:Cyp2d26 UTSW 15 82794008 missense probably benign 0.00
R7272:Cyp2d26 UTSW 15 82792563 missense probably benign
X0021:Cyp2d26 UTSW 15 82790517 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GAGTCACTTGGTGATGCACAGG -3'
(R):5'- CATGAGTCACTATATACAGGCAAGC -3'

Sequencing Primer
(F):5'- ACTTGGTGATGCACAGGACTCTAC -3'
(R):5'- CTATATACAGGCAAGCACATGTG -3'
Posted On2018-06-06