Incidental Mutation 'R6473:Chmp2b'
ID520370
Institutional Source Beutler Lab
Gene Symbol Chmp2b
Ensembl Gene ENSMUSG00000004843
Gene Namecharged multivesicular body protein 2B
Synonymschromatin modifying protein 2B, 1190006E07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.846) question?
Stock #R6473 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location65539128-65562726 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 65546872 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 96 (G96S)
Ref Sequence ENSEMBL: ENSMUSP00000156381 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004965] [ENSMUST00000231259]
Predicted Effect probably damaging
Transcript: ENSMUST00000004965
AA Change: G100S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000004965
Gene: ENSMUSG00000004843
AA Change: G100S

DomainStartEndE-ValueType
Pfam:Snf7 16 186 1e-45 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000231259
AA Change: G96S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 96.9%
  • 20x: 89.9%
Validation Efficiency 95% (36/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the heteromeric ESCRT-III complex (Endosomal Sorting Complex Required for Transport III) that functions in the recycling or degradation of cell surface receptors. ESCRT-III functions in the concentration and invagination of ubiquitinated endosomal cargos into intralumenal vesicles. The protein encoded by this gene is found as a monomer in the cytosol or as an oligomer in ESCRT-III complexes on endosomal membranes. It is expressed in neurons of all major regions of the brain. Mutations in this gene result in one form of familial frontotemporal lobar degeneration. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a hypomorphic gene trapped allele display reduced dendritic spine and excitatory synapse density in the hippocampus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts1 T C 16: 85,799,643 D106G probably damaging Het
Adat3 A G 10: 80,606,967 D213G probably damaging Het
Akt1 T C 12: 112,662,260 D32G probably damaging Het
Ampd1 C T 3: 103,095,646 R61* probably null Het
Ash2l T A 8: 25,834,980 T184S probably damaging Het
B3galnt1 T C 3: 69,575,340 N196S possibly damaging Het
Cyp2d26 T C 15: 82,791,767 N248S probably benign Het
Cyp46a1 G T 12: 108,355,475 R320L possibly damaging Het
Dact1 A G 12: 71,317,698 T418A probably benign Het
Ddx3y T C Y: 1,265,971 Y342C possibly damaging Homo
Dnm3 T A 1: 162,477,705 Q40L probably damaging Het
Eif2s1 T C 12: 78,881,225 I225T probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Eps8 A T 6: 137,479,098 I795N probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fbxw7 T C 3: 84,952,380 probably benign Het
Gba C T 3: 89,204,081 P51L probably benign Het
Idh3b AG AGCACCACAACTG 2: 130,279,673 probably null Het
Kalrn A G 16: 34,205,302 I551T probably damaging Het
Madd T C 2: 91,167,059 T755A probably benign Het
Mrps31 A G 8: 22,414,865 D90G probably benign Het
Olfr115 T A 17: 37,609,996 T252S possibly damaging Het
Olfr191 A T 16: 59,086,043 L147M probably benign Het
P2ry12 T A 3: 59,217,511 I248F probably benign Het
Ptgfrn T C 3: 101,045,639 R760G probably damaging Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Homo
Slpi T C 2: 164,354,926 Y116C probably damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Terb1 T A 8: 104,473,037 E425V probably damaging Het
Thbs2 A G 17: 14,685,796 S281P probably benign Het
Tnik A G 3: 28,263,643 M1V probably null Het
Usp16 G A 16: 87,483,135 S741N probably benign Het
Usp48 T C 4: 137,609,108 probably null Het
Vipr1 T C 9: 121,668,555 S380P probably damaging Het
Vmn1r21 A T 6: 57,843,598 I287K probably damaging Het
Zfp157 T C 5: 138,455,926 C129R probably damaging Het
Other mutations in Chmp2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01596:Chmp2b APN 16 65562477 missense probably benign 0.01
IGL01807:Chmp2b APN 16 65540205 missense probably benign
R0256:Chmp2b UTSW 16 65540192 missense probably benign 0.18
R1688:Chmp2b UTSW 16 65551036 missense probably benign 0.00
R1923:Chmp2b UTSW 16 65545327 missense possibly damaging 0.56
R2155:Chmp2b UTSW 16 65546991 missense probably benign 0.09
R4845:Chmp2b UTSW 16 65550976 missense probably damaging 0.99
R5559:Chmp2b UTSW 16 65540430 missense probably damaging 1.00
R6333:Chmp2b UTSW 16 65540250 missense possibly damaging 0.75
R7142:Chmp2b UTSW 16 65546908 nonsense probably null
R7339:Chmp2b UTSW 16 65545346 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GAATGTCCTTTTAACACCCCAATC -3'
(R):5'- GATACTCTCTGATGACTGCCCC -3'

Sequencing Primer
(F):5'- CACTAAGCTAGATGCACAATTACTTG -3'
(R):5'- GATGACTGCCCCTTGATTTTATTTC -3'
Posted On2018-06-06